Back to results
US 6,747,141 B2Granted
Methods and compositions for detection of mycobacterium avium complex species
AssigneeGen-Probe Incorporated
InventorsSteven T. Brentano, Roger L. Lankford
Life of this patent
Estimating the term…
Abstract
Methods of detecting Mycobacterium avium complex (MAC) organisms using in vitro nucleic acid amplification with amplification oligonucleotides specific for 16S rRNA or DNA sequences encoding 16S rRNA from MAC species are disclosed. Compositions and kits containing oligonucleotides for amplifying and detecting 16S rRNA or DNA sequences encoding 16S rRNA from MAC species are disclosed.
Claims12
A combination of at least two oligonucleotides selected from the group consisting of:
- a base sequence consisting of a target-specific sequence of SEQ ID NO:3 (GCCCATTGTGCAATATTCCCCACT),
- a base sequence consisting of SEQ ID NO:3, and
- a base sequence consisting essentially of SEQ ID NO:8.
A kit containing at least one oligonucleotide selected from the group consisting of
- a base sequence consisting of a target-specific sequence of SEQ ID NO:3 (GCCCATTGTGCAATATTCCCCACT),
- a base sequence consisting of SEQ ID NO::3, and
- a base sequence consisting of SEQ ID NO:8.
Dependencies are inferred from the claim text.