# US 6,723,840 B1 · Identification and expression of a novel kinesin motor protein

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 6,723,840 B1
- Document ID: US6723840B1
- Status: Granted
- Kind: B1
- Application number: 09/724,586
- Filed: 2000-11-28
- Granted: 2004-04-20
- Earliest claimed: 1998-01-23
- Assignees: The Regents of the University of California
- Inventors: Roman Sakowicz; Lawrence S. B. Goldstein
- Web page: https://patentgrep.com/patent/US6723840B1

## CPC

- C07K 14/37: from fungi
- C07K: PEPTIDES (peptides in foodstuffs A23; obtaining protein compositions for foodstuffs, working-up proteins for foodstuffs A23J; preparations for medicinal purposes A61K; peptides containing beta-lactam rings C07D; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, C07D; ergot alkaloids of the cyclic peptide type C07D519/02; macromolecular compounds having statistically distributed amino acid units in their molecules, i.e. when the preparation does not provide for a specific; but for a random sequence of the amino acid units, homopolyamides and block copolyamides derived from amino acids C08G69/00; macromolecular products derived from proteins C08H1/00; preparation of glue or gelatine C09H; single cell proteins, enzymes C12N; genetic engineering processes for obtaining peptides C12N15/00; compositions for measuring or testing processes involving enzymes C12Q; investigation or analysis of biological material G01N33/00)

## Abstract

The invention provides isolated nucleic acid and amino acid sequences of TL-γ, antibodies to TL-γ, methods of screening for TL-γ modulators using biologically active TL-γ, and kits for screening for TL-γ modulators.

## Claims

### Claim 1

An isolated nucleic acid sequence encoding a Thermomyces lanuginosus-γ, (TL-γ) protein comprising amino acids 1 to 357 of SEQ ID NO:1.

### Claim 2 (depends on 1)

The isolated nucleic acid sequence of claim 1, wherein the nucleic acid is isolated from a hyphal fungus.

### Claim 3 (depends on 2)

The isolated nucleic acid sequence of claims 2, wherein said fungus is Thermomyces lanuginosus.

### Claim 4 (depends on 1)

An expression vector comprising the nucleic acid sequence of claim 1.

### Claim 5 (depends on 4)

A host cell transfected with the vector of claim 4.

### Claim 6 (depends on 1)

The nucleic acid sequence of claim 1, wherein the protein has plus end-directed microtubule motor activity.

### Claim 7 (depends on 1)

The isolated nucleic acid sequence of claim 1, wherein the encoded protein further comprises amino acids 358 to 442 of SEQ ID NO:1.

### Claim 8 (depends on 1)

The isolated nucleic acid sequence of claim 1, wherein the nucleic acid is amplified by primer set SEQ ID NO:5 and SEQ ID NO:6 or by primer set SEQ ID NO:5 and SEQ ID NO:7.

### Claim 9 (depends on 8)

The nucleic acid sequence of claim 8, wherein the protein has plus end-directed microtubule motor activity.

### Claim 10 (depends on 1)

The isolated nucleic acid sequence of claim 1, wherein the nucleic acid is amplified by the primer set:
5′ ATGTCGGGCGGTOGAAATATC 3′ (SEQ ID NO:3)
5′ GAATTCCTGCTTCGCTGTTTTCA 3′ (SEQ ID NO:4).

### Claim 11

An isolated (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.

### Claim 12

An isolated nucleic acid sequence comprising nucleotide sequence of SEQ ID NO:2.

### Claim 13

An isolated (TL-γ) nucleic acid sequence encoding a protein comprising amino acids 1 to 357 of SEQ ID NO:1, said isolated nucleic acid sequence comprising sequence 5′ GATATTTCCACCGCCCGACAT 3′ (SEQ ID NO:8) that is complementary to 5′ ATGTCGGGCOGTGGAAATATC 3′ (SEQ ID NO:3), or comprising sequence 5′ TGAAAACAGCGAAGCAGGAATTC 3′ (SEQ ID NO:9) that is complementary to 5′ GAATTCCTGCTTCGCTGTTTTCA 3′ (SEQ ID NO:4), wherein said isolated nucleic acid sequence encodes a protein having plus end-directed microtubule motor activity.

### Claim 14

An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1-1071 of SEQ ID NO:2.

### Claim 15 (depends on 14)

The nucleotide sequence of claim 14, wherein said sequence encodes a protein having plus-end directed microtubule motor activity.

### Claim 16

An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1327-1803 of SEQ ID NO:2.

### Claim 17

An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1804-2352 of SEQ ID NO:2.

### Claim 18

An isolated nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.

### Claim 19

An expression vector comprising a (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.

### Claim 20

A host cell transfected with an expression vector comprising a (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.

### Claim 21

An expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 602 to 784 of SEQ ID NO:1, wherein the protein has plus end-directed microtubule motor activity, and wherein the protein specifically binds to polyclonal antibodies to SEQ ID NO:1.

### Claim 22

A host cell transfected with an expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 602 to 784 of SEQ ID NO:1, wherein the protein has plus end-directed microtubule motor activity, and wherein the protein specifically binds to polyclonal antibodies to SEQ ID NO:1.

### Claim 23

An expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.

### Claim 24

A host cell transfected with an expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.