Hybrid DNA synthesis of mature insulin-like growth factors
AssigneeChiron Corporation
InventorsPablo D. T. Valenzuela, Guy Mullenbach
Life of this patent
Estimating the term…
Abstract
Methods and compositions are provided for efficient production of human insulin-like growth factor. Synthetic IGF I and IGF II genes are joined to leader and processing signals which provide for expression and secretion of the gene product in yeast. Enhanced yields of the product may then be recovered from the nutrient medium. Yeast strains S. cerevisiae AB103 (pYIGF-I-10/1) and AB103 (pYIGF-II-10/1) were deposited at the American Type Culture Collection on Apr. 23, 1983 and granted Accession Nos. 20673 and 20674, respectively.
Claims45
A method for producing mature, human insulin-like growth factor-I (IGF-I) in yeast cells, said method comprising growing yeast cells comprising a vector that comprises a DNA sequence, said DNA sequence encoding said IGF-I directly joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences recognized by said yeast cells downstream from and under the transcriptional regulatory control of a transcriptional initiation region compatible with said yeast cells, wherein said yeast cells are grown under conditions that provide for the production and secretion of said mature, human IGF-I, and isolating said mature, human IGF-I.
Purified mature, human insulin-like growth factor-I (IGF-I) devoid of other human proteins produced by the process comprising:
- culturing at least one yeast cell that comprises a vector comprising a DNA construct that encodes said IGF-I directly joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences recognized by the yeast cell, wherein said culturing is performed under conditions that provide for the production of mature, human IGF-I;
- and purifying said mature, human IGF-I.
A method for producing mature, human insulin-like growth factor-I (IGF-I) in yeast, said method comprising:
- preparing a first DNA fragment comprising a first DNA sequence encoding all or a portion of human IGF-I;
- preparing a second DNA fragment comprising a second DNA sequence encoding all or a portion of Saccharomyces α-factor secretion and processing sequences;
- joining said first and second DNA fragments by means of an adaptor to provide a third DNA fragment, wherein said third DNA fragment comprises the coding sequence for human IGF-I directly joined to Saccharomyces α-factor secretion and processing sequences;
- incorporating said third DNA fragment into an expression vector;
- transforming a yeast cell with said expression vector;
- and
- culturing said yeast cell under conditions that provide for production of mature, human IGF-I.
A DNA construct comprising a sequence coding for human insulin-like growth factor-I (IGF-I) directly joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences, wherein said DNA construct is capable of providing expression of mature,:
- human IGF-I.
A DNA construct comprising a synthetic coding sequence employing preferred yeast codons for human insulin-like growth factor-I (IGF-I) directly joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences wherein said coding sequence is downstream from and under transcriptional regulation of regulatory signals utilized by yeast, and capable of providing expression of mature, human IGF-I in yeast.
A fusion protein comprising the amino acid sequence of human IGF-I and a yeast α-factor secretory leader and signal sequence.
A DNA molecule comprising the nucleotide sequence:
- GlyProGluThrLeuCysGlyAlaGluLeuValAspAlaLeuGln 5′-GGTCCAGAAACCTTGTGTGGTGCTGAATTGGTCGATGCTTTGCAA CCAGGTCTTTGGAACACACCACGACTTAACCAGCTACGAAACGTT
- PheValCysGlyAspArgGlyPheTyrPheAsnLysProThrGlyTyrGlySerSerSer TTCGTTTGTGGTGACAGAGGTTTCTACTTCAACAAGCCAACCGGTTACGGTTCTTCTTCT AAGCAAACACCACTGTCTCCAAAGATGAAGTTGTTCGGTTGGCCAATGCCAAGAAGAAGA
- ArgArgAlaProGlnThrGlyIleValAspGluCysCysPheArgSerCysAspLeuArg AGAAGAGCTCCACAAACCGGTATCGTTGACGAATGTTGTTTCAGATCTTGTGACTTGAGA TCTTCTCGAGGTGTTTGGCCATAGCAACTGCTTACAACAAAGTCTAGAACACTGAACTCT
- ArgLeuGluMetTyrCysAlaProLeuLysProAlaLysSerAla AGATTGGAAATGTACTGTGCTCCATTGAAGCCAGCTAAGTCTGCT-3′ TCTAACCTTTACATGACACGAGGTAACTTCGGTCGATTCAGACGA.
A method for producing human insulin-like growth factor-I (IGF-I) in yeast cells, said method comprising growing yeast cells comprising a vector that comprises a DNA sequence, said DNA sequence encoding said IGF-I joined in proper reading frame with Saccharomyces α-factor secretary leader and processing signal sequences recognized by said yeast cells and downstream from and under the transcriptional regulatory control of a transcriptional initiation region compatible with said yeast cells, wherein said yeast cells are grown under conditions that provide for the production and secretion of human IGF-I, and isolating human IGF-I.
A method for producing human insulin-like growth factor-I (IGF-I) in yeast, said method comprising:
- preparing a first DNA fragment comprising a first DNA sequence encoding all or a portion of IGF-I;
- preparing a second DNA fragment comprising a second DNA sequence encoding all or a portion of Saccharomyces α-factor secretion and processing sequences;
- joining said first and second DNA fragments by means of an adaptor to provide a third DNA fragment, wherein said third DNA fragment comprises the coding sequence for human IGF-I joined to Saccharomyces α-factor secretion and processing sequences;
- incorporating said third DNA fragment into an expression vector;
- transforming a yeast cell with said expression vector;
- and
- culturing said yeast cell under conditions that provide for production of human IGF-I.
A DNA construct comprising a synthetic coding sequence employing preferred yeast codons for human insulin-like growth factor-I (IGF-I) joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences, wherein said coding sequence is downstream from and under transcriptional regulation of regulatory signals utilized by yeast, and capable of providing expression in yeast.
A DNA construct comprising a sequence coding for human insulin-like growth-factor I joined in proper reading frame with Saccharomyces α-factor secretory leader and processing signal sequences.
A fusion protein comprising the amino acid sequence of IGF-I and Saccharomyces alpha-factor secretory leader and signal sequences.
Dependencies are inferred from the claim text.