Nucleic acid sequences for detecting genetic markers for cancer in a biological sample

A combination of oligonucleotides used in a detection assay specific for a prostate specific antigen (PSA) target nucleic acid sequence, comprising:

• a first oligonucleotide consisting essentially of the base sequence of SEQ ID NO:18 that serves as a first amplification primer that hybridizes specifically to a first PSA-specific sequence contained in exon 3 of a PSA expressed gene sequence;
• a second oligonucleotide consisting essentially of a target-binding sequence of SEQ ID NO:30 (CCAGAGGGTGAACTTGCGCACACACG), and optionally a promoter sequence 5′ of the target-binding sequence, that serves as a second amplification primer wherein the target-binding sequence hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 4 of a PSA expressed gene sequence;
• and
• a third oligonucleotide that serves as a detection probe that hybridizes specifically to a third PSA-specific sequence contained in one or more exons of a PSA expressed gene sequence, wherein the third PSA-specific sequence is located between the first and second PSA-specific sequences.

A combination of oligonucleotides used in a detection assay specific for a prostate specific antigen (PSA) target nucleic acid sequence, comprising:

• a first oligonucleotide that consists essentially of SEQ ID NO:18, or a complementary base sequence or equivalent RNA thereof;
• a second ollgonucleotide that consists essentially of SEQ ID NO:30, or a complementary base sequence or equivalent RNA thereof;
• and
• a third oligonucleotide that consists essentially of SEQ ID NO:1, or a complementary base sequence or equivalent RNA thereof.

A method of detecting a prostate-specific antigen (PSA) nucleic acid in a biological sample containing nucleic acid, comprising the steps of:

• providing a nucleic acid sample containing a prostate-specific antigen (PSA) target nucleic acid;
• hybridizing to the PSA target nucleic acid a first oligonucleotide consisting essentially of a target-binding sequence of SEQ ID NO:30 (CCAGAGGGTGAACTTGCGCACACACG), and optionally a promoter sequence 5′ of the target-binding sequence, wherein the target-binding sequence hybridizes specifically to a first PSA-specific sequence contained in exon 4 of a PSA gene sequence;
• hybridizing a second ofigonucleotide consisting essentially of the base sequence of SEQ ID NO:18 to a nucleic acid strand complementary to the PSA target nucleic acid, wherein the second oligonucleotide hybridizes specifically to a second PSA-specific sequence contained in exon 3 of a PSA gene sequence;
• producing a plurality of amplification products of the PSA target nucleic acid by using at least one polymerase activity and the first and second oligonucleotides as amplification primers;
• providing a third oligonucleotide that serves as a detection probe that hybridizes specifically to the amplification products at a third PSA-specific sequence contained in one or more exons of a PSA gene sequence, wherein the third PSA-specific sequence is located between the PSA-specific sequence contained in exon 4 to which the first oligonucleotide hybridizes and the PSA-specific sequence contained in exon 3 to which the second oligonucleotide hybridizes.