Polynucleotides encoding Bordatella bronchiseptica fimbrial proteins (FimN), vectors, and expression systems therefor
AssigneeThe University of Tennessee Research Corporation
InventorsDavid A. Bemis, Stephen A. Kania, Robert N. Moore
Life of this patent
Estimating the term…
Abstract
In one aspect, the subject invention concerns the cloning and characterization of a previously unidentified gene, provisionally named fim N, encoding a fimbrial protein that is putatively involved in the attachment of B. bronchiseptica to respiratory epithelium. This gene has been subcloned into a bacterial expression vector, and the recombinant protein has been isolated and partially characterized.
Claims15
An isolated polynucleotide fragment encoding fim N of Bordetella bronchiseptica, or a fragment of fim N, wherein said fim N encodes a protein having at least about 75% sequence identity as compared to the amino acid sequence as set forth in SEQ ID NO:4;
- and wherein said fim N or fragment of fim N, increases the binding of attachment-deficient Bordetella bronchiseptica to epithelial cells when expressed in said attachment-deficient cells.
An isolated polynucleotide fragment encoding a fim N polypeptide of Bordetella bronchiseptica, wherein said polypeptide comprises amino acid residues 28 to 209 of SEQ ID NO:4.
A probe or primer comprising a sequence selected from the group consisting of:
- a) GGAAGCTTGCCATCACCAACTTATGTG (SEQ ID NO:1);
- b) GGAATTCGATTATCCTTATCAAGCCC (SEQ ID NO:2);
- and
- c) the complement of SEQ ID NO:1 or SEQ ID NO:2.
Dependencies are inferred from the claim text.