Back to results
US 6,280,942 B1Granted
Endonuclease
AssigneeThe Institute of Physical and Chemical Research
InventorsNobuhiro Morishima, Hikaru Mizumura, Takehiko Shibata
Life of this patent
Estimating the term…
Abstract
The present invention relates to a site-specific endonuclease which recognizes a specific nucleotide sequence, to a gene coding for the endonuclease, to a recombinant vector containing the gene, to a transformant containing the vector, and to a process for producing the endonuclease.
Claims2
A method of cleaving a DNA having a 26 base sequence GCCCAGACATATCCCTGAATGATACC (SEQ ID NO:1), comprising
- (a) reacting the DNA with a protein comprising the amino acid sequence of SEQ ID NO:3;
- and
- (b) cleaving the DNA such that said DNA is cleaved within said 26 base region producing staggered ends.
A method of detecting DNA having a 26 base sequence GCCCAGACATATCCCTGAATGATACC (SEQ ID NO:1), comprising
- (a) reacting the DNA with a protein comprising the amino acid sequence of SEQ ID NO:3;
- (b) cleaving the DNA such that said DNA is cleaved within said 26 base region producing staggered ends;
- and
- (c) detecting the cleaved DNA.
1 more element
Dependencies are inferred from the claim text.