Back to results
US 6,150,110 AGranted
HMGI(Y)-LAMA4* fusion oncogene, oncoprotein and methods of use
AssigneeThe Brigham and Women's Hospital, Inc.
InventorsJonathan Fletcher, Sheng Xiao
Life of this patent
Estimating the term…
Abstract
An oncogene designated HMGI(Y)-LAMA4* incorporates a HMGI(Y) domain fused through inversion and translocation to LAMA4*, a novel gene transcript with a epidermal-growth-factor-like/zinc-finger-like motif. Molecular characterization of HMGI(Y)-LAMA4* provides nucleic acid sequences and amino acid sequences useful for detection and treatment of certain tumors.
Claims7
An isolated nucleic acid sequence comprising a sequence selected from the group consisting of GGCAGACCCAAAAAACTGAAATGCAATGCT (SEQ ID NO:1) and SEQ ID NO:2.
Dependencies are inferred from the claim text.