Recombinant papilloma virus L1
AssigneeThe University of Queensland
InventorsIan Frazer, Jian Zhou
Life of this patent
Estimating the term…
Abstract
This invention relates to a recombinant papilloma virus L1 protein which can elicit an immune response which recognises papilloma virus VLP including L1 protein and can form extracellularly a multimeric structure or VLP wherein the multimeric structure comprises a plurality of recombinant papilloma virus L1 proteins. This invention also includes the use of the recombinant papilloma virus L1 protein to detect the presence of papilloma virus and can form the basis of a vaccine for prophylactic and therapeutic use.
Claims32
A recombinant papilloma virus L1 protein which has an amino acid sequence shown in FIGS. 1(a)-1(c) (SEQ ID NO:6).
A recombinant papilloma virus L1 protein which has an N terminal amino acid sequence including:
- MetArgGlySerHisHisHisHisHisHisGlyMetAlaSerMetThrGlyGlyGlnMetGlyArgAspLeuTyr AspAspAspAspLysAsp (SEQ ID NO:1).
A multimeric structure comprising a plurality of recombinant papilloma virus L1 proteins, wherein each of said recombinant papilloma virus L1 proteins has an N terminal amino acid sequence including (His).sub.6.
A recombinant DNA molecule having a nucleotide sequence selected from any one of the following:
- (a) A nucleotide sequence encoding a recombinant papilloma virus L1 protein and having a 5' nucleotide sequence including:
- ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTG TACGACGATGACGATAAGGAT (SEQ ID NO:2);
- (b) A nucleotide sequence that is complementary to the sequence in (a);
- and
- (c) A nucleotide sequence that is a synonymous sequence to the sequence in (a).
A recombinant DNA molecule encoding a recombinant papilloma virus L1 protein and having a 5' nucleotide sequence which includes six repeats of the trinucleotide sequence CAT wherein the recombinant DNA molecule has a nucleotide sequence as shown in FIGS. 1(a)-1(c) (SEQ ID NO:5).
A method for preparing a multimeric structure, comprising:
- (i) expressing in a bacterium a recombinant DNA molecule which encodes a recombinant papilloma virus L1 protein which has an N terminal amino acid sequence including (His).sub.6 ;
- (ii) substantially purifying said recombinant papilloma virus L1 protein;
- and
- (iii) forming said multimeric structure extracellularly from a plurality of molecules of said papilloma virus L1 protein.
Dependencies are inferred from the claim text.