Loading patent…
AssigneeThe Trustees of Columbia University in the City of New York
InventorsCarol M. Troy, Michael L. Shelanski
Estimating the term…
The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.
An oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID No. 1).
An oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3' (Seq ID No. 2).
Dependencies are inferred from the claim text.