Detection of prokaryotic organism by DNA hybridization
AssigneeThe Regents of the University of California
InventorsEric J. Stanbridge, Ulf Gobel
Life of this patent
Estimating the term…
Abstract
Biological probes useful for detecting mycoplasmas or prokaryotes in general, or specific mycoplasma and eubacterial species are derived from the ribosomal RNA gene by selecting particular nucleotide sequences common to the class of organisms being detected.
Claims63
A method for detecting the presence of mycoplasma specific nucleic acids, which comprises:
- contacting a medium, which may contain a nucleic acid or nucleic acid fragment from said mycoplasma having said particular nucleotide sequence, with an oligonucleotide, said oligonucleotide comprising a nucleotide sequence complementary to said particular nucleotide sequence, whereby said oligonucleotide hybridizes with any nucleic acid or nucleic acid fragment from said mycoplasma which may be present in said medium;
- and
- detecting the presence of any nucleic acid or nucleic acid fragment hybridized with said oligonucleotide;
- wherein said particular nucleotide sequence includes at least one of the following mycoplasma-specific sequence regions or a sequence region, of at least nine nucleotides, complementary to at least one of the following sequences:
- 5'AACACGTATC3', 5'CGAATCAGCTATGTCG3', 5'GAGGTT-AAC3', 5'ATCCGGATTTATT3', 5'TCTCAGTTCGGATTGA3', 5'AGGTGGTGCATGGTTG3', 5'TCCTGGCTCAGGAT3', 5'ATACATAGGT3', 5'AACTATGTGC3', 5'AATTTTTCACAATG3', 5'TCTCGGGTCT3', and 5'TAGATATATG3', wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine and - indicates a nucleotide deletion within the sequence;
- wherein said oligonucleotide hybridizes with the nucleic acid or nucleic acid fragment from mycoplasma but not nucleic acids from eukaryotic or from other prokaryotic organisms, and wherein said oligonucleotide comprises at least nine nucleotides but is less than the length of mycoplasma rRNA or the nucleic acid sequence encoding mycoplasma rRNA.
A mycoplasma-specific probe, in a form which hybridizes to a particular nucleotide sequence, wherein said mycoplasma-specific probe is shorter than a mycoplasma rRNA or a nucleic acid sequence which encodes the mycoplasma rRNA, characterized in that it hybridizes with said particular nucleotide sequence, said particular nucleotide sequence comprising at least one of the following mycoplasma-specific sequence regions or a sequence region, of at least nine nucleotides, complementary to at least one of the following sequences:
- 5'AACACGTATC3', 5'CGAATCAGCTATGTCG3', 5'GAGGTT-AAC3', 5'ATCCGGATTTATT3', 5'TCTCAGTTCGGATTGA3', 5'AGGTGGTGCATGGTTG3', 5'TCCTGGCTCAGGAT3', 5'ATACATAGGT3', 5'AACTATGTGC3', 5'AATTTTTCACAATG3', 5'TCTCGGGTCT3', 5'TAGATATATG3' and a fragment of one of the foregoing sequence regions or the sequence region complementary thereto, wherein said fragment comprises at least nine nucleotides, wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine and - indicates a nucleotide deletion within the sequence, wherein said mycoplasma-specific probe hybridizes with the particular nucleotide sequence but not nucleotide sequences from eukaryotic or from other prokaryotic organisms.
A method for determining the presence of a prokaryotic organism which contains a nucleic acid having a particular nucleotide sequence which is present in nucleic acids from prokaryotic organisms but absent in nucleic acids from eukaryotic organisms, which comprises:
- contacting a medium which may contain a nucleic acid or nucleic acid fragment from said prokaryotic organism with an oligonucleotide including a nucleotide sequence complementary to said particular nucleotide sequence, whereby said oligonucleotide hybridizes with any nucleic acid or nucleic acid fragment from said prokaryotic organism including said particular nucleotide sequence which may be present in said medium;
- and
- detecting the presence of any nucleic acid or nucleic acid fragment hybridized with said oligonucleotide, wherein said particular nucleotide sequence includes at least one of the following sequence regions or a sequence region, of at least ten nucleotides, complementary to at least one of the following sequences:
- 5'ACGGGTGAGT3', 5'TAATACCGCAT3', 5'TACGGGAGGCAGCAGT3', 5'GTGGGGAGCAAA3', 5'AGGATTAGATACCCT3', 5'CCGTAAACGAT3', 5'GAATTGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCATGT3', 5'TGTTGGGTTAAGTCCCGCAACGA3', 5'GGGATGACGT3', 5'ACGTGCTACAATG3', 5'CTAGTAATCG3', 5'TGTACACACCGCCCGTCA3', 5'AAGTCGTAACAAGGTA3', 5'TGGATCACCTCCTT3' and a fragment of any of the foregoing sequences wherein said fragment comprises at least ten nucleotides, wherein T represents thymine, G represents guanine, A represents adenine and C represents cytosine wherein said oligonucleotide hybridizes with nucleic acids from prokaryotic organisms but not nucleic acids from eukaryotic organisms.
A prokaryote-specific probe, shorter than a mycoplasma rRNA or a nucleic acid sequence which encodes the mycoplasma rRNA, wherein said probe hybridizes with a particular nucleotide sequence including at least one of the following prokaryotic sequence regions or a sequence region, of at least ten nucleotides, complementary to at least one of the following sequences:
- 5'ACGGGTGAGT3', 5'TAATACCGCAT3', 5'TACGGGAGGCAGCAGT3', 5'GTGGGGAGCAAA3', 5'AGGATTAGATACCCT3', 5'CCGTAAACGAT3', 5'GAATTGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCATGT3', 5'TGTTGGGTTAAGTCCCGCAACGA3', 5'GGGATGACGT3', 5'ACGTGCTACAATG3', 5'CTAGTAATCG3', 5'TGTACACACCGCCCGTCA3', 5'AAGTCGTAACAAGGTA3', 5'TGGATCACCTCCTT3' and a fragment of any of the foregoing sequences wherein said fragment comprises at least ten nucleotides, wherein T represents thymine, G represents guanine, A represents adenine and C represents cytosine wherein said prokaryote-specific probe comprises at least about ten nucleotides.
A method for identifying a particular nucleotide sequence for use as a probe specific for microorganisms from the class Mollicutes in general or for a given mycoplasma, ureaplasma, acholeplasma or spiroplasma species in particular, which method comprises:
- a) cloning the entire operon of ribosomal RNA or portions thereof of a particular species of mycoplasma into a suitable vector;
- b) probing the resulting ribosomal RNA gene fragments under preselected hybridization conditions with a non-mycoplasma prokaryotic ribosomal RNA operon or fragments thereof;
- c) characterizing the fragments which hybridize under said preselected hybridization conditions with said non-mycoplasma prokaryotic ribosomal RNA operon or fragments thereof;
- d) identifying mycoplasma-specific fragments by differential under said preselected hybridization conditions hybridization;
- e) subcloning mycoplasma-specific fragments into a sequencing vector;
- f) sequencing the resulting subcloned mycoplasma-specific fragments;
- g) repeating steps a)-f) for other members of the Class Mollicutes;
- h) comparing sequences obtained in steps f) and g);
- and
- i) identifying sequences common to all species of mycoplasma but differing from the corresponding sequences in non-mycoplasmal prokaryotes for use as mycoplasma-specific probes, or sequences specific for a given mycoplasma, ureaplasma, acholeplasma, or spiroplasma species for use as probes specific for individual species of mycoplasmas, ureaplasmas, acholeplasmas and spiroplasmas;
- or identifying for use as probes the sequences hybridizable to said mycoplasma-specific probes or probes specific for individual species of mycoplasmas, ureaplasmas, acholeplasmas and spiroplasmas;
- wherein said probes comprises at least nine nucleotides.
A method for determining the presence of a prokaryotic organism of the class Mollicutes which contains a nucleic acid including a particular nucleotide sequence which is present in nucleic acids from said prokaryotic organisms but absent in nucleic acids from other prokaryotic organisms, which method comprises:
- a) cloning the entire operon of ribosomal RNA or portions thereof of a particular species of mycoplasma into a suitable vector;
- b) probing the resulting ribosomal RNA gene fragments under preselected hybridization conditions with a non-mycoplasma prokaryotic ribosomal RNA operon or fragments thereof;
- c) characterizing the fragments which hybridize with said non-mycoplasma prokaryotic ribosomal RNA operon or fragments thereof;
- d) identifying mycoplasma-specific fragments by differential hybridization under said preselected hybridization conditions;
- e) subcloning mycoplasma-specific fragments into a sequencing vector;
- f) sequencing the resulting subcloned mycoplasma-specific fragments;
- g) repeating steps a)-f) for other members of the Class Mollicutes;
- h) comparing sequences obtained in steps f) and g);
- i) identifying sequences common to all species of mycoplasma but differing from the corresponding sequences in non-mycoplasmal prokaryotes for use as mycoplasma-specific probes, or sequences specific for a given mycoplasma, ureaplasma, acholeplasma, or spiroplasma species for use as probes specific for individual species of mycoplasmas, ureaplasmas, acholeplasmas and spiroplasmas;
- j) contacting a medium which may contain a nucleic acid or nucleic acid fragment from said prokaryotic organism, having said particular nucleotide sequence, with an oligonucleotide including a nucleotide sequence identified in step i) complementary to said particular nucleotide sequence, under said preselected hybridization conditions whereby said oligonucleotide hybridizes with any nucleic acid or nucleic acid fragment from said prokaryotic organism including said particular nucleotide sequence which may be present in said medium;
- and
- k) detecting the presence of any nucleic acid or nucleic acid fragment hybridized with said oligonucleotide.
An oligonucleotide having the sequence 3'GCTTAGTCGATACAGC5' or a sequence complementary to said sequence, wherein said oligonucleotide and said sequence complementary to it are each shorter than the gene encoding mycoplasma rRNA, and are each at least nine nucleotides in length.
An oligonucleotide having the sequence 5'CGAAUCAGCUAUGUCG3' or a sequence complementary to said sequence, wherein said oligonucleotide and said sequence complementary to it are each shorter than the mycoplasma rRNA, and are each at least nine nucleotides in length.
A method for determining the presence in a medium of a mycoplasma specific nucleic acid sequence, comprising the steps of:
- contacting the medium with an oligonucleotide, said oligonucleotide comprises a nucleotide sequence which is hybridizable to said mycoplasma specific nucleic acid sequence;
- and
- detecting the presence of the mycoplasma specific nucleic acid sequence hybridized with said oligonucleotide;
- wherein said oligonucleotide includes at least one of the following sequences or sequences, of at least nine nucleotides, complementary thereto:
- 5'AACACGTATC3', 5'CGAATCAGCTATGTCG3', 5'GAGGTT-AAC3', 5'ATCCGGATTTATT3', 5'TCTCAGTTCGGATTGA3', 5'AGGTGGTGCATGGTTG3', 5'TCCTGGCTCAGGAT3', 5'ATACATAGGT3', 5'AACTATGTGC3', 5'AATTTTTCACAATG3', 5'TCTCGGGTCT3', 5'TAGATATATG3', 5'AACACGUAUC3', 5'CGAAUCAGCUAUGUCG3', 5'GAGGUU-AAC3', 5'AUCCGGAUUUAUU3', 5'UCUCAGUUCGGAUUGA3', 5'AGGUGGUGCAUGGUUG3', 5'UCCUGGCUCAGGAU3', 5'AUACAUAGGU3', 5'AACUAUGUGC3', 5'AAUUUUUCACAAUG3', 5'UCUCGGGUCU3', and 5'UAGAUAUAUG3', and a fragment of any one of the foregoing sequences or their complementary sequences, wherein said fragment comprises at least nine nucleotides, wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine, U represents uracil, and - indicates a nucleotide deletion within the sequence wherein said oligonucleotide comprises at least nine nucleotides but is less than the length of mycoplasma rRNA or the nucleic acid sequence encoding mycoplasma rRNA.
A method for determining the presence of a prokaryotic organism in a medium, comprising the steps of:
- contacting the medium which may contain a nucleic acid sequence from said prokaryotic organism with an oligonucleotide which hybridizes with the nucleic acid sequence of said prokaryotic organism;
- and
- detecting the presence of the nucleic acid sequence of said prokaryotic organism which hybridized with said oligonucleotide, wherein said oligonucleotide includes at least one of the following sequences of at least ten nucleotides, or sequences complementary to at least one of the following sequences:
- 5'ACGGGTGAGT3', 5'TAATACCGCAT3', 5'TACGGGAGGCAGCAGT3', 5'GTGGGGAGCAAA3', 5'AGGATTAGATACCCT3', 5'CCGTAAACGAT3', 5'GAATTGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCATGT3', 5'TGTTGGGTTAAGTCCCGCAACGA3', 5'GGGATGACGT3', 5'ACGTGCTACAATG3', 5'CTAGTAATCG3', 5'TGTACACACCGCCCGTCA3', 5'AAGTCGTAACAAGGTA3',5'TGGATCACCTCCTT3',5'ACGGGUGAGU3', 5'UAAUACCGCAU3', 5'UACGGGAGGCAGCAGU3', 5'GUGGGGAGCAAA3', 5'AGGAUUAGAUACCCU3', 5'CCGUAAACGAU3', 5'GAAUUGACGGGG3', 5'CCCGCACAAG3',5'GGTGGAGCAUGU3', 5'UGUUGGGUUAAGUCCCGCAACGA3', 5'GGGAUGACGU3', 5'ACGUGCUACAAUG3', 5'CUAGUAAUCG3', 5'UGUACACACCGCCCGUCA3', 5'AAGUCGUAACAAGGUA3', 5'UGGAUCACCUCCUU3' and a fragment of any of the foregoing sequences and their complementary sequences wherein said fragment comprises at least ten nucleotides, wherein T represents thymine, G represents guanine, A represents adenine and C represents cytosine, U represents uracil wherein said oligonucleotide comprises at least ten nucleotides but is less than the length of the prokaryote rRNA or the nucleic acid sequence encoding the prokaryote rRNA.
A composition comprising a synthesized and isolated oligonucleotide having the sequence 3'GCTTAGTCGATACAGC5' or a sequence complementary to said sequence, or fragments of the foregoing of between 10 to 16 nucleotides in length, wherein said oligonucleotide hybridizes to nucleic acid sequence of mycoplasma but not to nucleic acid sequence of another prokaryote or eukaryote.
A composition comprising a synthesized and isolated oligonucleotide having the sequence 5'CGAAUCAGCUAUGUCG3' or a sequence complementary to said sequence, or fragments of the foregoing of between 10 to 16 nucleotides in length, wherein said oligonucleotide hybridizes to nucleic acid sequence of mycoplasma but not to nucleic acid sequence of another prokaryote or eukaryote.
A composition comprising a synthesized and isolated mycoplasma-specific probe, wherein said probe hybridizes with a particular nucleotide sequence, said particular nucleotide sequence comprises at least one of the following mycoplasma-specific sequence regions or a sequence region, of at least nine nucleotides, complementary to at least one of the following sequences:
- 5'AACACGTATC3', 5'CGAATCAGCTATGTCG3', 5'GAGGTT-AAC3', 5'ATCCGGATTTATT3', 5'TCTCAGTTCGGATTGA3', 5'AGGTGGTGCATGGTTG3', 5'TCCTGGCTCAGGAT3', 5'ATACATAGGT3', 5'AACTATGTGC3', 5'AATTTTTCACAATG3', 5'TCTCGGGTCT3', 5'TAGATATATG3', 5'AACACGUAUC3', 5'CGAAUCAGCUAUGUCG3', 5'GAGGUU-AAC3', 5'AUCCGGAUUUAUU3', 5'UCUCAGUUCGGAUUGA3', 5'AGGUGGUGCAUGGUUG3', 5'UCCUGGCUCAGGAU3', 5'AUACAUAGGU3', 5'AACUAUGUGC3', 5'AAUUUUUCACAAUG3', 5'UCUCGGGUCU3', 5'UAGAUAUAUG3', and a fragment of any one of the foregoing sequences or their complementary sequences, wherein said fragment comprises at least nine nucleotides, wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine, U represents uracil and - indicates a nucleotide deletion within the sequence, wherein said mycoplasma-specific probe hybridizes with the particular nucleotide sequence but not nucleotide sequences from eukaryotic or other prokaryotic organisms.
A composition comprising a synthesized and isolated prokaryote-specific probe, wherein said probe hybridizes with a particular nucleotide sequence including at least one of the following prokaryotic sequence regions or a sequence region, of at least ten nucleotides, complementary to at least one of the following sequences:
- 5'ACGGGTGAGT3', 5'TAATACCGCAT3', 5'TACGGGAGGCAGCAGT3', 5'GTGGGGAGCAAA3', 5'AGGATTAGATACCCT3', 5'CCGTAAACGAT3', 5'GAATTGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCATGT3',5'TGTTGGGTTAAGTCCCGCAACGA3', 5'GGGATGACGT3', 5'ACGTGCTACAATG3', 5'CTAGTAATCG3', 5'TGTACACACCGCCCGTCA3', 5'AAGTCGTAACAAGGTA3', 5'TGGATCACCTCCTT3', 5'ACGGGUGAGU3', 5'UAAUACCGCAU3', 5'UACGGGAGGCAGCAGU3', 5'GUGGGGAGCAAA3', 5'AGGAUUAGAUACCCU3', 5'CCGUAAACGAU3', 5'GAAUUGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCAUGU3', 5'UGUUGGGUUAAGUCCCGCAACGA3', 5'GGGAUGACGU3', 5'ACGUGCUACAAUG3', 5'CUAGUAAUCG3', 5'UGUACACACCGCCCGUCA3', 5'AAGUCGUAACAAGGUA3', 5'UGGAUCACCUCCUU3' and a fragment of any of the foregoing sequences or their complementary sequences, wherein said fragment comprises at least ten nucleotides, wherein T represents thymine, G represents guanine, A represents adenine C represents cytosine and U represents uracil.
A method for determining the presence of a prokaryotic organism in a medium, comprising the steps of:
- contacting the medium which may contain a nucleic acid sequence from said prokaryotic organism with a synthesized and isolated oligonucleotide which under preselected hybridization conditions hybridizes with the nucleic acid sequence of said prokaryotic organism;
- and
- detecting the presence of the nucleic acid sequence of said prokaryotic organism which hybridized with said oligonucleotide,
- wherein said oligonucleotide comprises a section substantially complementary to the nucleic acid sequence of the prokaryotic organism such that under said preselected hybridization conditions said section hybridizes to the nucleic acid sequence of the prokaryotic organism but not to the nucleic acid sequence of a non-prokaryotic organism, said section being from nine nucleotides to twenty-three nucleotides. sequence but not to a non-mycoplasma-specific nucleic acid sequence.
A composition comprising a synthesized and isolated oligonucleotide which under preselected hybridization conditions hybridizes to a mycoplasma-specific nucleic acid sequence but not to a non-mycoplasma-specific nucleic acid sequence.
A composition comprising a synthesized and isolated oligonucleotide which comprises a section substantially complementary to the nucleic acid sequence of a prokaryotic organism such that under preselected hybridization conditions said section hybridizes to the nucleic acid sequence of the prokaryotic organism but not to the nucleic acid sequence of a non-prokaryotic organism, said section being from nine nucleotides to twenty-three nucleotides.
A composition comprising a synthesized and isolated oligonucleotide which comprises a section having a defined nucleic acid sequence substantially complementary to the nucleic acid sequence of a prokaryotic organism such that under preselected hybridization conditions said section hybridizes to the nucleic acid sequence of the prokaryotic organism but not to the nucleic acid sequence of a non-prokaryotic organism.
A composition comprising a synthesized and isolated oligonucleotide which comprises a section having a defined nucleic acid sequence substantially complementary to the nucleic acid sequence of a mycoplasma such that under preselected hybridization conditions said section hybridizes to the nucleic acid sequence of the mycoplasma but not to the nucleic acid sequence of an eukaryote or of another prokaryote.
A composition consisting essentially of an oligonucleotide having the sequence 3'GCTTAGTCGATACAGC5' or a sequence complementary to said sequence, or fragments of the foregoing of between 10 to 16 nucleotides in length, wherein said oligonucleotide hybridizes to nucleic acid sequence of mycoplasma but not to nucleic acid sequence of another prokaryote or eukaryote.
A composition consisting essentially of an oligonucleotide having the sequence 5' CGAAUCAGCUAUGUCG3' or a sequence complementary to said sequence, or fragments of the foregoing of between 10 to 16 nucleotides in length, wherein said oligonucleotide hybridizes to nucleic acid sequence of mycoplasma but not to nucleic acid sequence of another prokaryote or eukaryote.
A composition consisting essentially of a mycoplasma-specific probe, wherein said probe hybridizes with a particular nucleotide sequence, said particular nucleotide sequence comprises at least one of the following mycoplasma-specific sequence regions or a sequence region, of at least nine nucleotides, complementary to at least one of the following sequences:
- 5'AACACGTATC3', 5'CGAATCAGCTATGTCG3', 5'GAGGTT-AAC3', 5'ATCCGGATTTATT3', 5'TCTCAGTTCGGATTGA3', 5'AGGTGGTGCATGGTTG3', 5'TCCTGGCTCAGGAT3', 5'ATACATAGGT3', 5'AACTATGTGC3', 5'AATTTTTCACAATG3', 5'TCTCGGGTCT3', 5'TAGATATATG3', 5'AACACGUAUC3', 5'CGAAUCAGCUAUGUCG3', 5'GAGGUU-AAC3', 5'AUCCGGAUUUAUU3', 5'UCUCAGUUCGGAUUGA3', 5'AGGUGGUGCAUGGUUG3', 5'UCCUGGCUCAGGAU3', 5'AUACAUAGGU3', 5'AACUAUGUGC3', 5'AAUUUUUCACAAUG3', 5'UCUCGGGUCU3', 5'UAGAUAUAUG3', and a fragment of any one of the foregoing sequences or their complementary sequences, wherein said fragment comprises at least nine nucleotides, wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine, U represents uracil and - indicates a nucleotide deletion within the sequence, wherein said mycoplasma-specific probe hybridizes with the particular nucleotide sequence but not nucleotide sequences from eukaryotic or other prokaryotic organisms.
A composition consisting essentially of a prokaryote-specific probe, wherein said probe hybridizes with a particular nucleotide sequence including at least one of the following prokaryotic sequence regions or a sequence region, of at least ten nucleotides, complementary to at least one of the following sequences:
- 5'ACGGGTGAGT3', 5'TAATACCGCAT3', 5'TACGGGAGGCAGCAGT3', 5'GTGGGGAGCAAA3', 5'AGGATTAGATACCCT3', 5'CCGTAAACGAT3', 5'GAATTGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCATGT3', 5'TGTTGGGTTAAGTCCCGCAACGA3', 5'GGGATGACGT3', 5'ACGTGCTACAATG3', 5'CTAGTAATCG3', 5'TGTACACACCGCCCGTCA3', 5'AAGTCGTAACAAGGTA3', 5'TGGATCACCTCCTT3', 5'ACGGGUGAGU3', 5'UAAUACCGCAU3', 5'UACGGGAGGCAGCAGU3', 5'GUGGGGAGCAAA3', 5'AGGAUUAGAUACCCU3', 5'CCGUAAACGAU3', 5'GAAUUGACGGGG3', 5'CCCGCACAAG3', 5'GGTGGAGCAUGU3', 5'UGUUGGGUUAAGUCCCGCAACGA3', 5'GGGAUGACGU3', 5'ACGUGCUACAAUG3', 5'CUAGUAAUCG3', 5'UGUACACACCGCCCGUCA3', 5'AAGUCGUAACAAGGUA3', 5'UGGAUCACCUCCUU3' and a fragment of any of the foregoing sequences or their complementary sequences, wherein said fragment comprises at least ten nucleotides, wherein T represents thymine, G represents guanine, A represents adenine, C represents cytosine and U represents uracil.
A composition consisting essentially of an oligonucleotide which under preselected hybridization conditions hybridizes to a mycoplasma-specific nucleic acid sequence but not to a non-mycoplasma-specific nucleic acid sequence.
A composition consisting essentially of a synthesized and isolated oligonucleotide which comprises a section substantially complementary to the nucleic acid sequence of a prokaryotic organism such that said section hybridizes under preselected hybridization conditions to the nucleic acid sequence of the prokaryotic organism but not to the nucleic acid sequence of a non-prokaryotic organism, said section being from nine nucleotides to twenty-three nucleotides.
A composition consisting essentially of a synthesized and isolated oligonucleotide which comprises a section having a defined nucleic acid sequence substantially complementary to the nucleic acid sequence of a prokaryotic organism such that said section hybridizes under said preselected hybridization conditions to the nucleic acid sequence of the prokaryotic organism but not to the nucleic acid sequence of a non-prokaryotic organism.
A composition consisting essentially of an oligonucleotide which comprises a section having a defined nucleic acid sequence substantially complementary to the nucleic acid sequence of a mycoplasma such that said section hybridizes under said preselected hybridization conditions to the nucleic acid sequence of the mycoplasma but not to the nucleic acid sequence of an eukaryote or of another prokaryote.
A method for determining the presence of a prokaryotic organism in a medium comprising the steps of:
- contacting the medium, which may contain a target nucleic acid sequence from said prokaryotic organism, with a synthesized and isolated oligonucleotide which under preselected hybridization conditions hybridizes with said target nucleic acid sequence but does not hybridize with non-target nucleic acid sequences in said medium;
- and
- detecting, under said preselected hybridization conditions, the presence of said target nucleic acid sequence.
A method for determining the presence of a prokaryotic organism having a specified nucleic acid sequence, comprising the steps of:
- contacting nucleic acid sequences from said prokaryotic organism with an oligonucleotide which under preselected hybridization conditions hybridizes with said specified nucleic acid sequence but does not hybridize with non-specified nucleic acid sequences;
- and
- detecting the presence of any nucleic acid sequence with which said oligonucleotide hybridizes under said preselected hybridization conditions.
A composition comprising a synthesized and isolated oligonucleotide sequence which is substantially complementary to a target nucleic acid sequence of a preselected prokaryotic organism but which is not substantially complementary to non-target nucleic acid sequences.
A composition comprising a synthesized and isolated oligonucleotide which hybridizes under preselected hybridization conditions to a preselected nucleic acid sequence of a prokaryotic organism but not to non-selected nucleic acid sequences.
A composition comprising a synthesized and isolated oligonucleotide having at least nine nucleotides and which is substantially complementary to, and hybridizes under stringent hybridization conditions with, a target nucleic acid sequence of a preselected prokaryotic organism but does not hybridize with non-target nucleic acid sequences under said stingent hybridization conditions.
Dependencies are inferred from the claim text.