Inhibition of viruses by antisense oligomers capable of binding to polypurine rich tract of single-stranded RNA or RNA-DNA hybrids
AssigneeMax-Planck-Gesellschaft zur Forderung der Wissenschafter e.V.
InventorKarin Moelling
Life of this patent
Estimating the term…
Abstract
The present invention provides methods of inhibiting a virus with which a vertebrate is infected and which replicates via an RNA template comprising the administration of an antisense or triplex-forming oligonucleotide or a derivative thereof capable of binding to a polypurine-rich tract in a region of single-stranded RNA or RNA-DNA hybrid, respectively. Chimeric oligonucleotides capable of forming triplex structures with single-stranded nucleic acids are also disclosed.
Claims5
An oligonucleotide of from about 25 to about 54 nucleotides comprising UUUUGUUUUGGGGGGUGUGGUUGGG (SEQ ID NO:41) which binds to a polypurine-rich tract of an RNA-DNA hybrid containing pyrimidines within a sequence of contiguous purines of a viral nucleic acid having said tract, or a derivative of said oligonucleotide for enhancing stability to nuclease attack and/or increasing cellular uptake.
An oligonucleotide of from about 25 to about 54 nucleotides comprising TTTTCTTTTCCCCCCTGACCTTCCC (SEQ ID NO:3) which binds to a polypurine-rich tract of an RNA-DNA hybrid containing pyrimidines within a sequence of contiguous purines of a viral nucleic acid having said tract, or a derivative of said oligonucleotide for enhancing stability to nuclease attack and/or increasing cellular uptake.
An oligonucleotide of from about 25 to about 54 nucleotides comprising AAAAGAAAAGGGGGGACTGGAGGG (SEQ ID NO:7) which binds to a polypurine-rich tract of an RNA-DNA hybrid containing pyrimidines within a sequence of contiguous purines of a viral nucleic acid having said tract, or a derivative of said oligonucleotide for enhancing stability to nuclease attack and/or increasing cellular uptake.
An oligonucleotide of from about 25 to about 54 nucleotides comprising CCCTTCCAGTCCCCCCTTTTCTTTT (SEQ ID NO:8) which binds to a polypurine-rich tract of an RNA-DNA hybrid containing pyrimidines within a sequence of contiguous purines of a viral nucleic acid having said tract, or a derivative of said oligonucleotide for enhancing stability to nuclease attack and/or increasing cellular uptake.
An oligonucleotide of about 54 nucleotides comprising TTTTCTTTTGGGGGGTTTGGTTGGGTTTTCCCTTCCAGTCCCCCCTTTTCTTTT (SEQ ID NO:12) which binds to a polypurine-rich tract containing pyrimidines within a sequence of contiguous purines of a viral nucleic acid having said tract, or a derivative of said oligonucleotide for enhancing stability to nuclease attack and/or increasing cellular uptake.
Dependencies are inferred from the claim text.