Expression inhibitor comprising an antisense oligonucleotide derivative corresponding to human interleukin-6 receptor
AssigneeChugai Seiyaku Kabushiki Kaisha
InventorJun Fujita
Life of this patent
Estimating the term…
Abstract
There is provided an inhibitor of expression of human IL-6R, whose effective component is an antisense oligonucleotide derivative which hybridizes to the region of a nucleotide sequence of 9 to 30 nucleotides including the translation initiation codon of mRNA coding for human interleukin-6 receptor (IL-6R).
Claims8
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide wherein said antisense oligonucleotide has the nucleotide sequence GCCGACGGCCAGCAT (SEQ ID NO. 2).
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide wherein said antisense oligonucleotide has the nucleotide sequence CATGCTTCCTCCTCGGCTAC (SEQ ID NO. 3).
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide wherein said antisense oligonucleotide has the nucleotide sequence GATGCTTCCTCCTCG (SEQ ID NO. 4).
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide wherein said antisense oligonucleotide has the nucleotide sequence GGCCAGCATGCTTCCTCCTC (SEQ ID NO. 5).
An inhibitor of expression of human IL-6 receptor, consisting an antisense oligonucleotide derivative,
- wherein said antisense oligonucleotide derivative has the structure:
- ##STR3## wherein X is independently sulfur, a lower alkyl group, a primary amine, a secondary amine, or a lower alkoxy;
- Y is independently oxygen or sulfur;
- B is adenine, guanine, thymine or cytosine;
- R is independently hydrogen, dimethoxytrityl or a lower alkyl group;
- and
- n is 13, and said antisense oligonucleotide derivative has the nucleotide sequence GCCGACGGCCAGCAT (SEQ ID NO. 2).
An inhibitor of expression of human IL,6 receptor, consisting of an antisense oligonucleotide derivative,
- wherein said antisense oligonucleotide derivative has the structure:
- ##STR4## wherein X is independently sulfur, a lower alkyl group, a primary amine, a secondary amine, or a lower alkoxy;
- Y is independently oxygen or sulfur;
- B is adenine, guanine, thymine or cytosine;
- R is independently hydrogen, dimethoxytrityl or a lower alkyl group;
- and
- n is from 18, and said antisense oligonucleotide derivative has the nucleotide sequence CATGCTTCCTCCTCGGCTAC (SEQ ID NO. 3).
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide derivative,
- wherein said antisense oligonucleotide derivative has the structure:
- ##STR5## wherein X is independently sulfur, a lower alkyl group, a primary amine, a secondary amine, or a lower alkoxy;
- Y is independently oxygen or sulfur;
- B is adenine, guanine, thymine or cytosine;
- R is independently hydrogen, dimethoxytrityl or a lower alkyl group;
- and
- n is from 13, and said antisense oligonucleotide derivative has the nucleotide sequence GATGCTTCCTCCTCG (SEQ ID NO. 4).
An inhibitor of expression of human IL-6 receptor, consisting of an antisense oligonucleotide derivative,
- wherein said antisense oligonucleotide derivative has the structure:
- ##STR6## wherein X is independently sulfur, a lower alkyl group, a primary amine, a secondary amine, or a lower alkoxy;
- Y is independently oxygen or sulfur;
- B is adenine, guanine, thymine or cytosine;
- R is independently hydrogen, dimethoxytrityl or a lower alkyl group;
- and
- n is from 18, and said antisense oligonucleotide derivative has the nucleotide sequence GGCCAGCATGCTTCCTCCTC (SEQ ID NO. 5).
Dependencies are inferred from the claim text.