Humanized antibodies reactive with GPIIB/IIIA

#The present invention relates generally to the combination of recombinant DNA and monoclonal antibody technologies for developing novel biologics and, more particularly, for example, to the production of non-immunogenic (in humans) immunoglobulins specific for the GPIIb/IIIa antigen and their uses in vitro and in vivo.

#Cardiovascular disease is a leading cause of death and disability in developed countries. Atherosclerosis, or narrowing and hardening of the arteries, is a major contributor to cardiovascular disease. Arterial thrombosis, the formation of a blood clot or thrombus, commonly occurs in arteries effected by atherosclerosis, especially when a rupture occurs in a plaque that has built up on the vessel wall. The formation of a thrombus in a coronary artery can cause an acute myocardial infarction (heart attack) if the blockage is sustained, or unstable angina if the blockage is transient. A thrombus in a cerebral artery can cause a stroke or a transient ischemic attack. An arterial thrombus is composed of an aggregation of small blood cells called platelets together with the protein fibrin.

#The glycoprotein GPIIb/IIIa is found on the surface of platelets and plays a key role in their aggregation and hence the formation of thrombi (see, generally, Phillips et al., Blood 71, 831 (1988), which is incorporated herein by reference). The GPIIb/IIIa complex is composed of one molecule of GPIIb (M.W.=140 kDa), which itself consists of a large (M.W.=125 kDa) and small (M.W.=25 kDa) chain linked by one or more disulfide bonds and one molecule of GPIIIa (M.W.=105 kDa), which is a single polypeptide chain. Ca.sup.2+ ions are required to maintain the heterodimeric structure of GPIIb/IIIa, which is a member of the integrin family of adhesion molecules. When platelets are activated by a physiological agonist such as thrombin, adenosine diphosphate (ADP) or epinephrine, the structure or environment of the GPIIb/IIIa molecules on the surface of the platelets is altered so they can bind the serum protein fibrinogen. The fibrinogen cross-links the platelets so they form aggregates. GPIIb/IIIa is also a receptor for the adhesive proteins fibronectin, von Willebrand factor and vitronectin, and therefore contributes to the adhesion and spreading of platelets on the subendothelium of injured blood vessels.

#FIG. 1. Scheme for anchored polymerase chain reaction (PCR) cloning of the heavy and light chain variable domain cDNAs. RNA was prepared from about 10.sup.7 hybridoma cells using the hot phenol extraction method. Briefly, cells were resuspended and vortexed in 1 ml of RNA extraction buffer (50 mM sodium acetate pH 5.2/1% SDS), extracted with 0.5 ml of phenol pH 5.2 at 65.degree. C. for 15 min, followed by another 15 min. on ice. The aqueous phase was recovered and precipitated twice with ethanol. cDNA was synthesized from 10 ug of total RNA using reverse transcriptase (BRL, Bethesda, MD) and oligo dT.sub.12-18 (Pharmacia, Piscatway, N.J.) as primers. A poly(dG) tail was attached to the 3' end of the cDNA using terminal deoxynucleotide transferase (BRL) (E. Y. Loh et al., Science 243, 217 (1989)). The variable domain genes (V) were amplified using AmpliTaq (Perkin Elmer-Cetus) with the primer mcO45 (TAATCTAGAATTCCCCCCCCCCCCCCCCC) ›SEQ. ID NO:1! that hybridized to the poly(dG) tails and primers that hybridized to the constant region genes (C). For the light chain, the primer used was mcO46 (TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC) ›SEQ. ID NO:2!. For the heavy chain, the primer used was mcO47 (TATAGAGCTCAAGCTTCCAGTGGATAGAC(CAT)GATGGGG(GC)TGT(TC)GTTTTGGC) ›SEQ. ID NO:3!. The sequence in parenthesis indicates a base degeneracy. The degeneracy was introduced so that the primer would be able to hybridize to most gamma chains. The amplified fragments were then digested with EcoRI and HindIII and cloned into pUC18 vector for sequencing.

#FIGS. 2A and 2B. Sequences of the cDNA and translated amino acid sequences of the light chain (A) ›SEQ. ID NOS:4 and 5! and heavy chain (B) ›SEQ. ID NOS:6 and 7! variable regions of the antibody C4G1. The CDR sequences are underlined. The mature light chain protein begins with amino acid 21 D and the mature heavy chain protein with amino acid 20 Q, preceded by the respective signal sequences.

#FIGS. 3A and 3B. Schematic diagram of the plasmids pVg1-dhfr (A) and pVk (B). The plasmid pVg1-dhfr contains the following parts: an approximately 4200 base pair BamHI-EcoRI fragment containing the amp and dhfr genes; a 630-bp fragment containing the human cytomegalovirus (CMV) IE1 gene promoter and enhancer (Boshart et al., Cell 41, 521 (1985), which is incorporated herein by reference) flanked at the 5' and 3' ends by EcoRI and XbaI linkers respectively; and a 2800 bp HindIII-PvuII fragment containing the human gamma-1 constant region gene with 215 bp of the preceding intron and the poly(A) signal (Ellison et al., Nucleic Acids Res. 10, 4071 (1982), which is incorporated herein by reference). The plasmid pVk was similarly constructed, with a 1530-bp EcoRI-XbaI fragment containing the human kappa constant region gene and about 335 bp of the preceding intron (Hieter et al., Cell 22, 197 (1980), which is incorporated herein by reference) replacing the gamma-1 gene; and the gpt gene replacing the dhfr gene. The fragments containing the human gamma-1 and kappa constant region genes were flanked at their 5' and 3' ends respectively by created XbaI and BamHI sites. The plasmids were constructed from the indicated parts using methods well-known in the art (see, Maniatis et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

#In accordance with the present invention, humanized immunoglobulins specifically reactive with GPIIb/IIIa related epitopes are provided. These immunoglobulins, which have binding affinities to GPIIb/IIIa of at least about 10.sup.7 M.sup.-1, and preferably 10.sup.8 M.sup.-1 to 10.sup.10 M.sup.-1 or stronger, are capable of, e.g., preventing platelet aggregation. The humanized immunoglobulins will have a human framework and will have one or more complementarity determining regions (CDR's) from an immunoglobulin, typically a mouse immunoglobulin, specifically reactive with GPIIb/IIIa antigen. In a preferred embodiment, one or more of the CDR's will come from the C4G1 antibody. Thus, the immunoglobulins of the present invention, which can be produced economically in large quantities, find use, for example, in the treatment of platelet-mediated disorders in human patients by a variety of techniques.

#The basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.

#Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, and define the antibody's isotype as IgG, IgM, IgA, IgD and IgE, respectively. Within light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 more amino acids. (See, generally, Fundamental Immunology, Paul, W., Ed., Chapter 7, pgs. 131-166, Raven Press, New York (1984), which is incorporated herein by reference.)