Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
AssigneeRegents of the University of Minnesota
InventorsHarry T. Orr, Laura P. W. Ranum, Ming-Yi Chung, Huda Y. Zoghbi
Life of this patent
Estimating the term…
Abstract
The present invention provides an isolated DNA sequence of the short arm of chromosome 6 which is located within the autosomal dominant spinocerebellar ataxia type 1 gene. This isolated DNA sequence is preferably located within a 3.36 kb EcoRI fragment, i.e., an EcoRI fragment containing about 3360 base pairs, of the SCA1 gene. The isolated sequence preferably contains a CAG repeat region. The number of CAG trinucleotide repeats (n) is.ltoreq.36, preferably n=19-36, for normal individuals. For an affected individual n>36, preferably n.gtoreq.43.
Claims13
A method for identifying individuals at risk for developing spinocerebellar ataxia type 1 comprising the step of:
- analyzing the CAG repeat region of a spinocerebellar ataxia type 1 gene wherein individuals at risk for developing spinocerebellar ataxia type 1 have greater than or equal to 43 CAG repeats.
An isolated DNA fragment having a sequence comprising bases 1716-1749 of SEQ ID NO:1 of a spinocerebellar ataxia type 1 gene and a CAG repeat region.
Isolated oligonucleotide primers selected from the group consisting of CCGGAGCCCTGCTGAGGT (SEQ ID NO:8), CCAGACGCCGGGACAC (SEQ ID NO:9), AACTGGAAATGTGGACGTAC (SEQ ID NO:10), CAACATGGGCAGTCTGAG (SEQ ID NO:11), CCACCACTCCATCCCAGC (SEQ ID NO:12), TGCTGGGCTGGTGGGGGG (SEQ ID NO:13), CTCTGGCTTTCTTGGTG (SEQ ID NO:14), and GTACGTCCACATTTCCAGTT (SEQ ID NO:15) useful for detecting spinocerebellar ataxia type 1.
Dependencies are inferred from the claim text.