# US 5,707,827 A · Mutant AOX2 promoter, vector carrying same, transformant and production of heterologous protein

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 5,707,827 A
- Document ID: US5707827A
- Status: Granted
- Kind: A
- Application number: 08/281,025
- Filed: 1994-07-27
- Granted: 1998-01-13
- Earliest claimed: 1993-07-27
- Assignees: The Green Cross Corporation
- Inventors: Hideyuki Ohi; Masami Miura; Ryuji Hiramatsu; Takao Ohmura
- Web page: https://patentgrep.com/patent/US5707827A

## CPC

- C12N 15/815: {for yeasts other than Saccharomyces}
- C07K 14/765: Serum albumin, e.g. HSA
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- C07K: PEPTIDES (peptides in foodstuffs A23; obtaining protein compositions for foodstuffs, working-up proteins for foodstuffs A23J; preparations for medicinal purposes A61K; peptides containing beta-lactam rings C07D; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, C07D; ergot alkaloids of the cyclic peptide type C07D519/02; macromolecular compounds having statistically distributed amino acid units in their molecules, i.e. when the preparation does not provide for a specific; but for a random sequence of the amino acid units, homopolyamides and block copolyamides derived from amino acids C08G69/00; macromolecular products derived from proteins C08H1/00; preparation of glue or gelatine C09H; single cell proteins, enzymes C12N; genetic engineering processes for obtaining peptides C12N15/00; compositions for measuring or testing processes involving enzymes C12Q; investigation or analysis of biological material G01N33/00)

## Abstract

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

## Claims

### Claim 1

A mutant AOX2 promoter wherein 1 to 3 copies of the oligonucleotide GATAGGCTATTTTTGTCGCATAAAT (SEQ ID NO: 2) is (are) added in the forward orientation, the reverse orientation or in both the forward and reverse orientations at the 5' end of a partial DNA fragment of a wild-type AOX2 promoter of Pichia pastoris.

### Claim 2 (depends on 1)

The mutant AOX2 promoter of claim 1, wherein the partial DNA fragment comprises at least nucleotides 1325-1528 of SEQ ID NO: 1.

### Claim 3 (depends on 2)

The mutant AOX2 promoter of claim 2, further comprising nucleotides 1-1324 of SEQ ID NO:1, wherein at least one base of nucleotides 1-1324 is substituted or deleted, or at least one base is added to nucleotides 1-1324.

### Claim 4 (depends on 1)

The mutant AOX2 promoter of claim 1, wherein the partial DNA fragment comprises at least nucleotides 1274-1528 of SEQ ID NO: 1.

### Claim 5 (depends on 4)

The mutant AOX2 promoter of claim 4, further comprising nucleotides 1-1273 of SEQ ID NO:1, wherein at least one base of nucleotides 1-1324 is substituted or deleted, or at least one base is added to nucleotides 1-1324.

### Claim 6 (depends on 1)

The mutant AOX2 promoter of claim 1, wherein the partial DNA fragment comprises at least nucleotides 1192-1528 of SEQ ID NO: 1.

### Claim 7 (depends on 6)

The mutant AOX2 promoter of claim 6, further comprising nucleotides 1-1191 of SEQ ID NO:1, wherein at least one base of nucleotides 1-1324 is substituted or deleted, or at least one base is added to nucleotides 1-1324.

### Claim 8 (depends on 1)

The mutant AOX2 promoter of claim 1, wherein the partial DNA fragment comprises at least nucleotides 845-1528 of SEQ ID NO: 1.

### Claim 9 (depends on 8)

The mutant AOX2 promoter of claim 8, further comprising nucleotides 1-844 of SEQ ID NO:1, wherein at least one base of nucleotides 1-1324 is substituted or deleted, or at least one base is added to nucleotides 1-1324.

### Claim 10 (depends on 1, 3, 4, 6, 8)

The mutant AOX2 promoter of any one of claims 1, 4, 6, 8 or 3, wherein at least one base of nucleotides 1274-1314 is substituted or deleted, or at least one base is added to nucleotides 1274-1314.

### Claim 11 (depends on 1, 3, 5, 6, 8)

The mutant AOX2 promoter of any one of claims 1, 6, 8, 3 or 5, wherein at least one base of nucleotides 1192-1216 is substituted or deleted, or at least one base is added to nucleotides 1192-1216.

### Claim 12 (depends on 1, 2, 3, 4, 5, 6)

The mutant AOX2 promoter of any one of claims 1, 2, 4, 6, 3 or 5 comprising:
a) substitution of the 1274th thymine with cytosine,
b) addition of nucleotides 1296-1314 between the 1314th nucleotide and 1315th nucleotide,
c) substitution of the 1209th guanine with thymine,
d) substitution of the 1212th thymine with guanine,
e) substitution of the 1193rd adenine with guanine or
f) substitution of the 1195th adenine with guanine.

### Claim 13 (depends on 1)

A vector carrying the mutant AOX2 promoter of claim 1.

### Claim 14 (depends on 13)

The vector of claim 13, comprising a structural gene of a heterologous protein under the transcription regulation of the mutant AOX2 promoter.

### Claim 15 (depends on 14)

The vector of claim 14, wherein the structural gene is selected from the group consisting of human serum albumin, prourokinase, tissue plasminogen activator and interferon.

### Claim 16 (depends on 13, 14, 15)

A transformant transformed with the vector of any one of claims 13 to 15.

### Claim 17 (depends on 16)

The transformant of claim 16, wherein the transformant is Pichia pastoris.

### Claim 18 (depends on 17)

A method for producing a heterologous protein, comprising culturing the transformant of claim 17 and collecting a heterologous protein from the culture thereof.