Somatostatin receptors
AssigneeAmerican Cyanamid Company
InventorsJohn Richard Hadcock, Bradley Alton Ozenberger, Mark Henry Pausch
Life of this patent
Estimating the term…
Abstract
The present invention relates to a method for isolating and cloning receptor DNA sequences. The invention also provides novel DNA sequences encoding a novel somatostatin receptor subtype.
Claims14
An oligonucleotide selected from the group consisting of the oligonucleotides depicted in FIG. 2A [SEQ ID NOs:9-13].
An oligonucleotide selected from the group consisting of the oligonucleotides depicted in FIG. 2B [SEQ ID NOs:14-18].
An oligonucleotide having the sequence GGGTCGCCTCCATTTCGG [SEQ ID NO:5].
An oligonucleotide having the sequence CGAGCGCCTCCGCCTTGAGG [SEQ ID NO:7].
A nucleic acid fragment encoding a somatostatin receptor protein, comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:
- 1 or SEQ ID NO:
- 2.
A nucleic acid fragment encoding a somatostatin receptor, the fragment comprising the sequence depicted in FIG. 7 [SEQ ID NO:3].
A nucleic acid fragment comprising the sequence depicted in SEQ ID NO:
- 2.
A nucleic acid fragment comprising the sequence depicted in SEQ ID NO:
- 1.
A vector expressing a nucleic acid sequence selected from the group of sequences depicted in SEQ ID NOs:
- 1-3.
Dependencies are inferred from the claim text.