Antiviral polynucleotide conjugates
AssigneeAllelix Biopharmaceuticals Inc.
InventorsShane Climie, Michael Ma
Life of this patent
Estimating the term…
Abstract
The herpes simplex virus encodes ICP4, a DNA binding protein. ICP4-binding duplexed structures having significantly enhanced stability under physiological conditions are described. The structures are provided in the form of polynucleotide conjugates capable of adopting a duplexed structure, in which annealable polynucleotide strands are coupled covalently at one or both ends through a chemical linker which establishes a stabilizing bridge between strands. The present polynucleotide conjugates have therapeutic utility against viral infection as the polynucleotide strands thereof define a binding site for a viral regulatory protein, thereby inactivating the protein and preventing viral replication from occurring.
Claims13
A duplex-forming polynucleotide conjugate having the general formula (I):
- X--L--Y (I)
- wherein:
- X and Y are first and second polynucleotide strands capable of annealing to form an ICP4 protein binding site;
- and
- L is a first chemical linker coupled covalently between the 3' end of said first polynucleotide strand and the 5' end of said second polynucleotide strand to form a duplexed ICP4 protein-binding structure.
A polynucleotide conjugate having the following formula (III), SEQ ID NOS:6 and 7,
- 5' CGCTATCGTCCATACCGACCAC
- L.sub.A (III)
- 3' GCGATAGCAGGTATGGCTGGTG
- wherein L.sub.A is a chemical linker.
A polynucleotide conjugate comprising first and second complementary polydeoxyribonucleotide strands which are capable of annealing to form a herpes simplex virus ICP4 binding site, wherein the 3' terminus of said first polydeoxyribonucleotide strand is coupled covalently the 5' terminus of said second polydeoxyribonucleotide strand.
Dependencies are inferred from the claim text.