Back to results
US 5,292,874 AGranted
Nucleic acid probes to Staphylococcus aureus
AssigneeGen-Probe Incorporated
InventorCurt L. Milliman
Life of this patent
Estimating the term…
Abstract
Hybridization assay probes specific for Staphylococcus aureus and no other Staphylococcus species.
Claims2
An oligonucleotide probe having the nucleotide sequence CCACTCAAGAGAGACAACATTTTCGACTAC (SEQ ID NO. 1), or its complementary sequence, whereby said probe, when under hybridization conditions, is able to distinguish Staphylococcus aureus from Staphylococcus cohnii, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus intermedius, Staphylococcus saprophyticus, Staphylococcus simulans, and Staphylococcus warneri.
Dependencies are inferred from the claim text.