Pre-grafted hydrogel for improved solid support surface adhesion

The functionalized solid support surface of claim 2, wherein the adhesion promoting biopolymer is an oligonucleotide having one of following nucleobase sequences:

• (SEQ ID No:
• 1)
• TTTTTTTTTTAATGATACGGCGACCACCGAGAUCTACAC,
• (SEQ ID No:
• 2)
• TTTTTTAATGATACGGCGACCACCGAGA/vinyl-T/CTACAC,
• and
• (SEQ ID No:
• 3)
• TTTTTTTTTTCAAGCAGAAGACGGCATACGAGAT,
• wherein the adhesion promoting oligonucleotide is configured to hybridize with the capture primer, and
• wherein the capture primer is configured to hybridize with the polynucleotide sample or a constituent(s) thereof.

A biological assay for detection of a nucleic acid sample, the assay comprising

• a functionalized solid support surface, wherein the solid support surface comprises a hydrogel layer adhered to the surface, wherein the hydrogel contains one or more adhesion promoting biopolymers;
• a capture primer bound to the solid support surface through interaction with the one or one or more adhesion promoting biopolymers;
• and
• a nucleic acid sample immobilized on the solid support surface via interaction with the capture primer.

A method for optical detection of a nucleic acid sample, the method comprising:

• providing a biological assay comprising:
• a functionalized solid support surface, wherein the solid support surface comprises a hydrogel layer adhered to the surface, wherein the hydrogel contains one or more adhesion promoting biopolymers;
• a capture primer covalently bound to the solid support surface through interaction with the one or one or more adhesion promoting biopolymers;
• and
• a nucleic acid sample immobilized on the solid support surface via interaction with the capture primer, wherein the nucleic acid samples comprises one or more fluorescent species.
• providing an optical detection system comprising an excitation source, one or more optical sensors, and a signal processor;
• irradiating, via the excitation source, at least a portion of the functionalized solid support surface with an incident light;
• detecting, via the one or more optical sensors, an output signal emitted by at least one of the one or more fluorescent species of the nucleic acid sample or constituent analyte(s) as an optic field response to the incident light;
• and
• obtaining from the output signal, via the signal processor, data indicative of a characteristic of the sample or constituent analyte(s).