Back to results
US 2026/0273102 A1Published application
Prime editing of single base mutations in sickle cell disease
AssigneeBeam Therapeutics Inc.
InventorHolly Rees
Life of this patent
Estimating the term…
Abstract
This disclosure provides compositions and methods for the editing of a HBB gene with prime editing.
Claims49
A prime editing guide RNA (PEgRNA) comprising:
- a spacer that is complementary to a search target sequence on a first strand of a Hemoglobin subunit beta (HBB) gene,
- an editing template that comprises a region of complementarity to an editing target sequence on a second strand of the HBB gene, and
- a gRNA core that associates with a prime editor comprising a DNA binding domain and a DNA polymerase domain,
- wherein the spacer sequence comprises CAUGGUGCACCUGACUCCUA (SEQ ID NO:
- ##).
2 more elements
3-4. (canceled)
(canceled)
8-9. (canceled)
11-12. (canceled)
14-22. (canceled)
25-28. (canceled)
30-31. (canceled)
33-42. (canceled)
44-48. (canceled)
52-57. (canceled)
59-60. (canceled)
(canceled)
(canceled)
(canceled)
69-71. (canceled)
(canceled)
75-77. (canceled)
80-81. (canceled)
83-89. (canceled)
(canceled)
(canceled)
Dependencies are inferred from the claim text.