Mapt sirna and uses thereof

An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein

• (a) the sense strand comprises 21 nucleotides having the sequence:
• CAAGUCCAAGAUCGGCUCCAA, wherein from the 5′end
• (i) the nucleotide at one or more of positions 1-6, 8, and 12-21 is optionally modified with 2′-O-methyl;
• (ii) the nucleotide at one or more of positions 9-11 is optionally modified with 2′-deoxy-2′fluoro;
• (iii) the nucleotide at position 7 optionally comprises a lipophilic moiety;
• wherein the sense strand optionally further comprises an inverse abasic nucleotide (InvAb) at the 5′ end linked to the nucleotide at position 1 and/or an inverse abasic nucleotide (InvAb) at the 3′ end linked to the nucleotide at position 21, and wherein the sense strand optionally comprises at least two phosphorothioate linkages at the 5′end and/or at least two phosphorothioate linkages at the 3′end;
• and
• (b) the antisense strand comprises 21 nucleotides having the sequence:
• UUGGAGCCGAUCUUGGACUUG, wherein from the 5′end
• (i) the nucleotide at position 1 is optionally modified with vinyl phosphonate 2′-O-methyl or cis-cyclobutyl phosphonate 2′-O-methyl;
• (ii) the nucleotide at one or more of positions 2, 14, and 16 is optionally modified with 2′-deoxy-2′fluoro;
• (iii) the nucleotide at one or more of positions 1, 3-6, 8-13, 15, and 17-21 is optionally modified with 2′-O-methyl;
• (iv) optionally, the nucleotide at one or more of positions 4, 5, and 7 is a deoxynucleotide;
• (v) optionally, the nucleotide at position 7 is a 3′-O-methyl modified nucleotide with 2′-5′ linked phosphate, a (L)-α-threofuranosyl (3′-2′) modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA);
• wherein the antisense strand optionally comprises at least two phosphorothioate linkages at the 5′end and/or at least two phosphorothioate linkages at the 3′end;
• and
• wherein the base pair at position 1 of the 5′-end of the antisense strand of the duplex is an AU base pair.