Compositions and methods for treating alpha-1 antitrypsin deficiency

A pharmaceutical composition comprising:

• a) a lipid nanoparticle comprising:
• i) a guide RNA (gRNA), wherein the gRNA comprises a nucleic acid sequence complementary to an alpha-1 antitrypsin nucleic acid sequence containing a single nucleotide polymorphism (SNP) associated with alpha-1 antitrypsin deficiency, and
• ii) mRNA encoding a base editor, wherein the base editor comprises a polynucleotide programmable DNA binding domain and at least one base editor domain that comprises an adenosine deaminase variant comprising an amino acid sequence having at least 90% identity to SEQ ID NO:
• 3 and further comprising an amino acid alteration selected from the group consisting of I76Y, V82T, Y147R, Y147T, and Q154S;
• and
• b) a pharmaceutically acceptable carrier, vehicle, or excipient.

A pharmaceutical composition comprising:

• a) a lipid nanoparticle comprising:
• i) a guide RNA (gRNA) comprising the gRNA targeting sequence AUCGACAAGAAAGGGACUGA (SEQ ID NO:
• 74), and
• ii) mRNA encoding a base editor, wherein the base editor comprises a Cas9 polypeptide having protospacer-adjacent motif (PAM) specificity for the nucleic acid sequence 5′-NGC-3′ and having at least 90% identity to SEQ ID NO:
• 13, and at least one base editor domain that comprises an adenosine deaminase variant comprising an amino acid sequence having at least 90% identity to SEQ ID NO:
• 3 and further comprising the amino acid alterations I76Y, V82T, Y147T, and Q154S;
• and
• b) a pharmaceutically acceptable carrier, vehicle, or excipient.