Methods for in vivo editing of klkb1
AssigneeIntellia Therapeutics, Inc.
InventorsDavid MAAG, David LEBWOHL, James BUTLER, Michael MAITLAND, Jonathan PHILLIPS, Yuanxin XU, Ahmed ABDELHADY ABOZEID
Life of this patent
Estimating the term…
Abstract
The first systemic administration of a CRISPR/Cas9-based therapeutic for in vivo editing of a liver KLKB1 gene in a clinical trial is described. Described herein are methods for in vivo editing of a liver KLKB1 gene by systemically administering a lipid nanoparticle composition comprising an mRNA encoding a Cas9 nuclease and a guide RNA that targets the gene. Assessment of biosafety metrics and clinical efficacy metrics, as well as methods of treatment, are also described herein.
Claims66
A method of treating hereditary angioedema (HAE) in a human subject comprising systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene in the liver.
A method of preventing HAE attacks in a human subject comprising systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene in the liver.
A method of reducing the frequency of angioedema attacks in a human subject with HAE comprising systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene in the liver.
A method for in vivo editing of the kallikrein (KLKB1) gene in a human subject having HAE, comprising:
- a. systemically administering to the human subject a LNP composition comprising an therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene;
- and
- b. editing the KLKB1 gene at the site targeted by the guide RNA in a hepatocyte of the subject;
- wherein the administration of the composition results in a clinically significant improvement in a level of a clinical metric in the subject as compared to a baseline level.
A method for treating hereditary angioedema (HAE) in a human subject, comprising:
- a. systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO:
- 15),
- wherein the administration of the composition reduces total plasma kallikrein protein level relative to baseline total plasma kallikrein protein level.
A method of treating hereditary angioedema (HAE) in a human subject comprising:
- a. systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene in the liver;
- b. determining a first level of a clinical metric in the subject prior to administration;
- c. determining a second level of the clinical metric in the subject a period of time after administration;
- and
- d. assessing the change between the first and the second levels of the clinical metric, wherein the administration of the composition results in a change in the level of the clinical metric in the subject that is improved as compared to a baseline level, thereby treating HAE.
A method of treating hereditary angioedema (HAE) in a human subject comprising:
- a. systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene in the liver;
- b. determining a first level of a biosafety metric in the subject prior to administration;
- c. determining a second level of the biosafety metric in the subject a period of time after administration;
- and
- d. assessing the change between the first and the second levels of the biosafety metric, wherein the administration of the composition results in a change in a level of a biosafety metric in the subject that is acceptable as compared to a baseline level.
A method of treating hereditary angioedema (HAE) in a human subject comprising:
- a. systemically administering to the human subject a LNP composition comprising an therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene,
- wherein the administration of the composition results in a clinically significant improvement in a level of a clinical metric in the subject as compared to a baseline level of the clinical metric.
A method for treating HAE in a human subject, comprising:
- a. systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene,
- wherein the mRNA encoding a Cas nuclease and the guide RNA that targets the KLKB1 gene are administered at a combined dose of about 25 mg to about 75 mg.
A method for treating HAE in a human subject, comprising:
- a. systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of:
- i. an mRNA encoding a Cas nuclease, and
- ii. a guide RNA that targets the KLKB1 gene,
- wherein the mRNA encoding a Cas nuclease and the guide RNA that targets the KLKB1 gene are administered at a combined dose of about 50 mg to about 75 mg.
Dependencies are inferred from the claim text.