Hcv detection
AssigneeDiagnostics for the Real World, Ltd.
InventorsSonny Michael ASSENNATO, Allyson Victoria RITCHIE
Life of this patent
Estimating the term…
Abstract
Methods for detecting Hepatitis C virus (HCV) nucleic acid are described. The methods are useful for point-of-care (POC) testing, and provide rapid tests able to detect several different HCV genotypes. Kits, primers, probes, sets of primers, sets of oligonucleotides, and oligonucleotides, and their use in the methods, are also described.
Claims32
A method for determining whether a sample includes HCV nucleic acid, which comprises amplifying nucleic acid of the sample, or amplifying nucleic acid derived from nucleic acid of the sample, by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6;
- wherein:
- the forward nucleic acid primer comprises a nucleic acid sequence of:
- AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1;
- and
- the reverse nucleic acid primer comprises a nucleic acid sequence of:
- GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
-3. (canceled)
A kit for determining whether a sample includes HCV nucleic acid, which comprises:
- a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, for amplifying a template nucleic acid by an isothermal amplification reaction, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6;
- a nucleic acid capture probe, wherein the capture probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6;
- and/or
- a nucleic acid detector probe, wherein the detector probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6, optionally wherein the detector probe comprises a visually detectable label for labelling a product of the isothermal nucleic acid amplification;
- wherein:
- the forward nucleic acid primer comprises a nucleic acid sequence of:
- AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1, and
- the reverse nucleic acid primer comprises a nucleic acid sequence of:
- GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
-18. (canceled)
A set of primers for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, which comprises a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6;
- wherein:
- the forward nucleic acid primer comprises a nucleic acid sequence of:
- AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1, and
- the reverse nucleic acid primer comprises a nucleic acid sequence of:
- GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
-28. (canceled)
-32. (canceled)
-39. (canceled)
Dependencies are inferred from the claim text.