Back to results
US 2026/0218169 A1Published application
Double stranded dna compositions and related methods
AssigneeFlagship Pioneering Innovations Vii, LLC
InventorsAlexandra Rachael Sneider, Jacob Rosenblum Rubens, Camilo Ayala Breton
Life of this patent
Estimating the term…
Abstract
The disclosure provides, for example, therapeutic double stranded constructs (TDSCs). In some embodiments, the TDSCs comprise a double stranded DNA region, an upstream closed end, and a downstream closed end. In some embodiments, the TDSC comprises chemically modified nucleotides. In some embodiments, the TDSC is resistant to endonuclease digestion and/or resistant to immune sensor recognition, and supports expression of a heterologous payload encoded in the TDSC.
Claims47
A TDSC comprising:
- a) an upstream DNA end form which is a closed end;
- b) a double stranded region;
- c) a downstream DNA end form which is a closed end,
- wherein the TDSC comprises one or more chemically modified nucleotides,
- wherein one or more chemically modified nucleotides comprise a chemically modified cytosine nucleotide and/or a phosphorothioate bond.
2 more elements
A TDSC comprising:
- a) an upstream exonuclease-resistant DNA end form;
- b) a double stranded region;
- and
- c) a downstream exonuclease-resistant DNA end form,
- wherein the TDSC comprises one or more chemically modified nucleotides.
2 more elements
A TDSC comprising:
- a) an upstream double stranded, blunt-ended DNA end form (e.g., an upstream exonuclease-resistant DNA end form that is double stranded and blunt-ended) comprising a phosphorothioate modification on each strand;
- b) a double stranded region;
- and
- c) a downstream double stranded, blunt-ended DNA end form (e.g., a downstream exonuclease-resistant DNA end form that is double stranded and blunt-ended) comprising a phosphorothioate modification on each strand.
1 more element
A TDSC comprising:
- a) an upstream exonuclease-resistant DNA end form;
- b) a double stranded region;
- c) a downstream exonuclease-resistant DNA end form,
- wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprises a Y-adaptor configuration,
- optionally wherein the TDSC comprises one or more chemically modified nucleotides.
2 more elements
A TDSC comprising:
- a) an upstream exonuclease-resistant DNA end form;
- b) a double stranded region;
- c) a downstream exonuclease-resistant DNA end form,
- wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprises one or more of:
- a nuclear targeting sequence, a maintenance sequence, or a sequence that binds an endogenous polypeptide in a target cell.
2 more elements
A TDSC comprising:
- a) an upstream exonuclease-resistant DNA end form;
- b) a double stranded region;
- c) a downstream exonuclease-resistant DNA end form,
- wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have one or more of the following characteristics:
- i) does not comprise the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO:
- 55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO:
- 56), or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto;
- and/or the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO:
- 57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO:
- 58);
- ii) every nucleotide in the TDSC binds another nucleotide in the TDSC;
- iii) the upstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length;
- or
- iv) the downstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length.
11 more elements
A pharmaceutical composition comprising a double stranded DNA (dsDNA) comprising an effector sequence, wherein:
- a) the dsDNA lacks a vector backbone or lacks a material portion of vector backbone, or does not comprise a non-human (e.g., bacterial) origin of replication;
- b) the dsDNA is unencapsidated, is essentially free of viral proteins, does not comprise a viral packaging signal, or does not comprise a viral ITR;
- c) the dsDNA comprises exonuclease-resistant ends;
- and
- d) the dsDNA comprises at least one chemically modified nucleotide.
2 more elements
A proto-TDSC comprising:
- a) an upstream exonuclease-resistant DNA end form;
- b) a double stranded region;
- c) a downstream exonuclease-resistant DNA end form,
- wherein:
- (i) the proto-TDSC comprises one or more (e.g., 1 or 2) uracil nucleotides, or
- (ii) the upstream exonuclease-resistant DNA end form comprises a sticky end, and/or wherein the downstream exonuclease-resistant DNA end form comprises a sticky end.
3 more elements
A method of making a TDSC, the method comprising ligating:
- a double-stranded DNA molecule to
- a self-annealed DNA molecule comprising a first region and a second region, wherein the first region is hybridized to the second region;
- thereby producing a TDSC,
- optionally wherein the self-annealed DNA molecule further comprises a loop between the first region and the second region.
1 more element
Dependencies are inferred from the claim text.