Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof
AssigneeAlnylam Pharmaceuticals, Inc.
InventorsAkin Akinc, James D. McIninch, Yesseinia Anglero-Rodriguez, Mark K. Schlegel
Life of this patent
Estimating the term…
Abstract
The present invention relates to RNAi agents, e.g., dsRNA agents, targeting the transmembrane serine protein 2 (TMPRSS2) gene. The invention also relates to methods of using such RNAi agents to inhibit expression of a TMPRSS2 gene and to methods of treating or preventing a TMPRSS2-associated disease, e.g., COVID-19, in a subject.
Claims32
A double stranded ribonucleic acid (dsRNA) agent, or a salt thereof, for inhibiting expression of transmembrane serine protease 2 (TMPRSS2) in a cell,
- wherein the dsRNA agent, or a salt thereof, comprises a sense strand and an antisense strand forming a double stranded region,
- wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence UUGAACAUUCCAGAUACCUAA (SEQ ID NO:
- 120) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence UUAGGUAUCUGGAAUGUUCAAUA (SEQ ID NO:
- 420);
- and
- wherein the sense strand or the antisense strand is conjugated to one or more lipophilic moieties.
2-10. (canceled)
(canceled)
15-17. (canceled)
19-20. (canceled)
22-28. (canceled)
30-31. (canceled)
33-41. (canceled)
43-49. (canceled)
53-68. (canceled)
71-72. (canceled)
75-77. (canceled)
79-85. (canceled)
87-95. (canceled)
Dependencies are inferred from the claim text.