Dux4-targeting engineered guide rnas and polynucleotides
AssigneeShape Therapeutics Inc.
InventorsYazmin Ines ROVIRA GONZALEZ, Brian BOOTH, Yiannis SAVVA, Lina Rajili BAGEPALLI, Yue JIANG, Bora BANJANIN, Ronald James HAUSE, JR.
Life of this patent
Estimating the term…
Abstract
Disclosed herein are engineered guide RNAs and compositions comprising the same for treatment of diseases or conditions in a subject. Also disclosed herein are methods of treating diseases or conditions in a subject by administering engineered guide RNAs or pharmaceutical compositions described herein.
Claims20
1-108. (canceled)
An engineered guide RNA capable of hybridizing to a DUX4 target sequence of a DUX4-FL mRNA, wherein the DUX4 target sequence comprises a polyA signal sequence, and wherein the engineered guide RNA has at least 90% sequence identity to SEQ ID NO:
- 39.
An AAV vector comprising a polynucleotide an engineered guide RNA, wherein the polynucleotide encoding the engineered guide RNA has a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO:
- 32.
An engineered guide RNA or a polynucleotide encoding the engineered guide RNA, comprising a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO:
- 32 or SEQ ID NO:
- 39
An engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA hybridizes to at least 80 bases of a target RNA sequence with at least 80% sequence identity to ACCUGGAUUAGAGUUACAUCUCCUGGAUGAUUAGUUCAGAGAUAUAUUAAAA UGCCCCCUCCCUGUGGAUCCUAUAGAAGAUUUGCAUCUUUUGUGUGAUGAGU GCAGAG (SEQ ID NO:
- 1) and facilitates a protein knockdown or an mRNA knockdown.
Dependencies are inferred from the claim text.