Chimeric antigen receptors specific for b-cell maturation antigen and encoding polynucleotides

A polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises:

• (a) a single chain variable fragment (scFv) or a single domain antibody (sdAb);
• (b) a spacer polypeptide comprising a hinge region, a CH2 domain, and a CH3 domain each derived all or in part from IgG4 and/or IgG2, wherein the nucleic acid sequence encoding the spacer includes, at the nucleotide positions corresponding to splice sites in the reference sequence of SEQ ID NO:621, at least one modified splice site selected from:
• (1) a modified splice donor comprising the contiguous nucleotides of SEQ ID NO:662 (tcaactggtatgtgg);
• (2) a modified splice acceptor comprising the contiguous nucleotides of SEQ ID NO:672 (cagtttcttcctgtatagtagactcaccgtggataaatcaa);
• or (3) a modified splice acceptor comprising the contiguous nucleotides of SEQ ID NO:766 (cgccttgtcctccttgtcccgctcctcctgttgccggacct);
• (c) a transmembrane domain;
• and (d) an intracellular signaling region comprising a CD3ζ signaling domain.