Compositions and methods for inhibition of expression of inhibin subunit beta e (inhbe) genes

A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand each 18 to 25 nucleotides in length, wherein:

• (a) the antisense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides ofAAGACGGCAGAAUGGAAAGAGGC (SEQ ID NO:
• 217);
• and
• (b) the sense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides of CUCUUUCCAUUCUGCCGUCUU (SEQ ID NO:
• 71);
• wherein at least one nucleotide of the dsRNA is a modified nucleotide selected from a 2′-O-methyl modified nucleotide or a 2′-fluoro modified nucleotide;
• wherein at least one internucleoside linkage is a phosphorothioate linkage;
• and
• wherein the dsRNA further comprises a ligand or targeting moiety that comprises at least one N-acetyl-galactosamine (GalNAc).

A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises an antisense strand of 23 nucleotides in length and a sense strand of 21 nucleotides in length, wherein:

• (a) the antisense strand comprises a nucleobase sequence of 17 contiguous nucleotides ofAAGACGGCAGAAUGGAAAGAGGC (SEQ ID NO:
• 217);
• and
• (b) the sense strand comprises a nucleobase sequence of 17 contiguous nucleotides of CUCUUUCCAUUCUGCCGUCUU (SEQ ID NO:
• 71);
• wherein the antisense strand has a 3′ end nucleotide overhang compared to the sense strand;
• wherein the antisense strand and the sense strand each comprise at least one modified nucleotide selected from a 2′-O-methyl modified nucleotide or a 2′-fluoro modified nucleotide;
• wherein the antisense strand and the sense strand each comprise at least one phosphorothioate linkage;
• and
• wherein the dsRNA further comprises a ligand or targeting moiety that comprises at least one N-acetyl-galactosamine (GalNAc), wherein the ligand or targeting moiety is conjugated to the 5′ end of the sense strand of the dsRNA.