Compositions and methods for inhibiting expression of the alas1 gene
AssigneesAlnyiam Pharmaceuticals, Inc., Icahn School of Medicine at Mount Sinai
InventorsBrian Bettencourt, Kevin Fitzgerald, William Querbes, Robert J. Desnick, Makiko Yasuda
Life of this patent
Estimating the term…
Abstract
The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.
Claims27
A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO:
- 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO:
- 4154).
A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40, or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 (SEQ ID NOs:
- 4172 to 5237).
-14. (canceled)
-23. (canceled)
-28. (canceled)
(canceled)
-44. (canceled)
-47. (canceled)
A method for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising:
- detecting the level of ALAS1 mRNA in a biological fluid sample from the subject, said biological fluid sample comprising the ALAS1 mRNA,
- thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
-59. (canceled)
Dependencies are inferred from the claim text.