Loading patent…
AssigneeThe Trustees of Columbia University in the City of New York
InventorsNourdine CHAKOURI, Manu BEN JOHNY, Steven O. MARX
Estimating the term…
Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.
A treatment composition for inhibiting late Na current, the composition comprising a viral or plasmid vector encoding FixR.
A treatment composition for inhibiting late Na current, the composition comprising a peptide inhibitor of late Na current, wherein the peptide inhibitor is FixR.
A method for inhibiting late Na current, comprising the step of administering to a patient in need thereof an effective amount of a treatment composition comprising a viral or plasmid vector encoding FixR or a peptide inhibitor of late Na current, wherein the peptide inhibitor is FixR.
Dependencies are inferred from the claim text.