Therapeutic nucleic acids and methods of use thereof
AssigneeCedars-Sinai Medical Center
InventorsEduardo Marbán, Ahmed G. Ibrahim
Life of this patent
Estimating the term…
Abstract
An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and/or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.
Claims31
(canceled)
An isolated nucleic acid comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:
- 12), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 30 nt long.
-22. (canceled)
A nucleic acid consisting of a nucleotide sequence:
- CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:
- 2), wherein the nucleic acid is RNA, wherein each of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence is a LNA.
-35. (canceled)
(canceled)
(canceled)
-43. (canceled)
-47. (canceled)
-56. (canceled)
-75. (canceled)
-87. (canceled)
A method of treating a condition associated with inflammation and/or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of a nucleic acid that specifically binds Translocated Promoter Region (TPR), thereby treating the condition associated with inflammation and/or fibrosis.
-93. (canceled)
Dependencies are inferred from the claim text.