# US 2024/0200152 A1 · Primer set, reagent composition and method for the detection of methicillin-resistant staphylococcus aureus (mrsa)

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2024/0200152 A1
- Document ID: US20240200152A1
- Status: Published application
- Kind: A1
- Application number: 18/556,185
- Filed: 2022-04-21
- Published: 2024-06-20
- Earliest claimed: 2021-04-22
- Applicants: Genomtec S.A.
- Inventors: Miron TOKARSKI; Malgorzata MALODOBRA-MAZUR
- Web page: https://patentgrep.com/patent/US20240200152A1

## CPC

- C12Q 1/689: for bacteria
- C12Q 1/6844: Nucleic acid amplification reactions
- C12Q 2600/156: Polymorphic or mutational markers
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES

## Abstract

The invention relates to a set of primers, a composition of reagents and a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) bacteria.

## Claims

### Claim 1

A set of primers for amplifying the nucleotide sequence of the methicillin-resistant Staphylococcus aureus (MRSA) mecA gene, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers comprising the following nucleotide sequences c) and d):
a) 5′ GAAGGTGTGCTTACAAGTGCTAATA 3′ (SEQ ID NO: 3) or a sequence at least 90% identical to SEQ ID NO: 3, linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′ CAACATGAAAAATGATTATGGCTC 3′ (SEQ ID NO: 4) or a sequence at least 90% identical to SEQ ID NO: 4;
b) 5′ TGACGTCTATCCATTTATGTATGGC 3′ (SEQ ID NO: 5) or a sequence at least 90% identical to SEQ ID NO: 5, linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′ AGGTTCTTTTTTTATCTTCGGTTA 3′ (SEQ ID NO: 6) or a sequence at least 90% identical to SEQ ID NO: 6;
c) 5′ TGATGCTAAAGTTCAAAAGAGT 3′ (SEQ ID NO: 1) or a sequence at least 90% identical to SEQ ID NO: 1, and
d) 5′ GTAATCTGGAACTTGTTGAGC 3′ nucleic sequence (SEQ ID NO: 2) or a sequence at least 90% identical to SEQ ID NO: 2.

### Claim 2 (depends on 1)

The set of primers of claim 1, characterized in that it comprises a loopF primer complementary to the MRSA mecA gene 5′ CCTGTTTGAGGGTGGATAGCAGTAC 3′ (SEQ ID NO: 7) or a sequence at least 90% identical to SEQ ID NO: 7.

### Claim 3 (depends on 1)

A method of detecting MRSA bacteria, characterized in that a selected region of the nucleic sequence of the bacterial genome is amplified using the set of primers as defined in claim 1, the amplification method being the LAMP method.

### Claim 4 (depends on 3)

The method of detecting bacteria of claim 3, characterized in that the amplification is carried out with a temperature profile of: 62° C., 40 min

### Claim 5 (depends on 4)

The method of claim 4, characterized in that an end-point reaction is carried out with a temperature profile of 80° C., 5 min.

### Claim 6 (depends on 3)

A method for detecting infection caused by the MRSA bacterium, characterized in that it comprises the detection method as defined in claim 3.

### Claim 7 (depends on 1)

A kit for detecting infection caused by the MRSA bacterium, characterized in that it comprises the set of primers as defined in claim 1.

### Claim 8 (depends on 7)

The kit for detecting infection of claim 7, characterized in that it comprises 5.0 μl of WarmStart LAMP Master Mix (NEB).

### Claim 9 (depends on 7)

The kit for detecting infection of claim 7, wherein the primers have the following concentrations:
primer c) at 0.13 μM,
primer d) at 0.13 μM,
primer b) at 1.06 μM, and
primer a) at 1.06 μM.

### Claim 10 (depends on 2)

A method of detecting MRSA bacteria, characterized in that a selected region of the nucleic sequence of the bacterial genome is amplified using the set of primers as defined in claim 2, the amplification method being the LAMP method.

### Claim 11 (depends on 10)

The method of detecting bacteria of claim 10, characterized in that the amplification is carried out with a temperature profile of:
−65.5° C., 40 min

### Claim 12 (depends on 11)

The method of claim 11, characterized in that the end-point reaction is carried out with a temperature profile of 80° C., for additional 5 min.

### Claim 13 (depends on 10)

A method for the detection of a MRSA bacterium infection, characterized in that it comprises the detection method of claim 10.

### Claim 14 (depends on 2)

A kit for the detection of a MRSA bacterium infection, characterized in that it comprises a set of primers as defined in claim 2.

### Claim 15 (depends on 14)

The infection detection kit of claim 14, characterized in that it comprises 5.0 μl of WarmStart LAMP 2× Master Mix (NEB).

### Claim 16 (depends on 14)

The infection detection kit of claim 14, wherein the primers have the following concentrations:
primer c) at 0.13 μM,
primer d) at 0.13 μM,
primer b) at 1.06 μM,
primer a) at 1.06 μM, and
loop primer at 0.26 μM.

### Claim 17 (depends on 9)

The infection detection kit of claim 9, comprising D-(+)-Trehalose dihydrate.

### Claim 18 (depends on 9)

The infection detection kit of claim 9, comprising a fluorescent marker interacting with double-stranded DNA.

### Claim 19 (depends on 14)

The infection detection kit of claim 14, comprising D-(+)-Trehalose dihydrate.

### Claim 20 (depends on 14)

The infection detection kit of claim 14, comprising a fluorescent marker interacting with double-stranded DNA.