# US 2024/0189451 A1 · Exosome gene therapy for treating inner ear disease

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2024/0189451 A1
- Document ID: US20240189451A1
- Status: Published application
- Kind: A1
- Application number: 18/286,450
- Filed: 2022-03-31
- Published: 2024-06-13
- Earliest claimed: 2022-03-31
- Assignees: University of Florida Research Foundation, Inc.
- Applicants: University of Florida Research Foundation, Incorporated
- Inventors: Mei He; Xiaoshu Pan
- Web page: https://patentgrep.com/patent/US20240189451A1

## CPC

- A61K 48/005: {characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered}
- C12N 15/907: {in mammalian cells}
- A61K 9/5063: {Compounds of unknown constitution, e.g. material from plants or animals (oils, fats, waxes, shellac A61K9/5015)}
- A61K 47/26: Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
- A61P 27/16: Otologicals
- C07K 14/4716: {Muscle proteins, e.g. myosin, actin}
- C12N 9/22: Ribonucleases {[RNase]; Deoxyribonucleases [DNase]}
- C12N 9/226: {Class 2 CAS enzyme complex, e.g. single CAS protein}
- C12N 15/111: {General methods applicable to biologically active non-coding nucleic acids}
- C12N 15/88: using microencapsulation, e.g. using {amphiphile} liposome vesicle
- A01K 2217/07: Animals genetically altered by homologous recombination
- A01K 2227/105: Murine
- A01K 2267/0306: Animal model for genetic diseases
- A61K 48/00: Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR]
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C07K: PEPTIDES (peptides in foodstuffs A23; obtaining protein compositions for foodstuffs, working-up proteins for foodstuffs A23J; preparations for medicinal purposes A61K; peptides containing beta-lactam rings C07D; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, C07D; ergot alkaloids of the cyclic peptide type C07D519/02; macromolecular compounds having statistically distributed amino acid units in their molecules, i.e. when the preparation does not provide for a specific; but for a random sequence of the amino acid units, homopolyamides and block copolyamides derived from amino acids C08G69/00; macromolecular products derived from proteins C08H1/00; preparation of glue or gelatine C09H; single cell proteins, enzymes C12N; genetic engineering processes for obtaining peptides C12N15/00; compositions for measuring or testing processes involving enzymes C12Q; investigation or analysis of biological material G01N33/00)
- A01K: ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS

## Abstract

Provided herein are compositions and methods useful in the treatment of hearing loss diseases, such as by correction of mutations in genes associated with hearing.

## Claims

### Claim 1

A method comprising providing to a subject a CRISPR-associated endonuclease, a guide RNA (gRNA), and a template nucleic acid, wherein the gRNA targets a MYO7A gene.

### Claim 2 (depends on 1)

The method of claim 1, wherein the CRISPR-associated endonuclease is Cas9.

### Claim 3 (depends on 1, 2)

The method of claim 1 or 2, wherein the CRISPR-associated endonuclease is provided as a protein.

### Claim 4

The method of any preceding claim, wherein the CRISPR-associated endonuclease is provided as a nucleic acid encoding a protein.

### Claim 5 (depends on 4)

The method of claim 4, wherein the nucleic acid is a messenger RNA (mRNA).

### Claim 6

The method of any preceding claim, wherein the CRISPR-associated endonuclease and the gRNA are provided as a ribonucleoprotein (RNP) complex or a nucleic acid encoding an RNP complex.

### Claim 7

The method of any preceding claim, wherein the template nucleic acid comprises a portion of a nucleic acid sequence encoding a wild-type MYO7A protein or a sequence capable of specifically binding to a portion of a nucleic acid sequence encoding a wild-type MYO7A protein.

### Claim 8 (depends on 7)

The method of claim 7, wherein the wild-type MYO7A protein is a mammalian MYO7A protein.

### Claim 9 (depends on 7)

The method of claim 7, wherein the wild-type MYO7A protein is a human MYO7A protein.

### Claim 10 (depends on 7)

The method of claim 7, wherein the wild-type MYO7A protein is a mouse MYO7A protein.

### Claim 11

The method of any preceding claim, wherein the gRNA comprises, consists essentially of, or consists of a nucleic acid sequence of 10-30 or 15-25 consecutive nucleotides of the sequence of NCBI Reference Sequence NM_001256081.1 (SEQ ID NO: 7), NM_001256082.1 (SEQ ID NO: 9), NM_001256083.1 (SEQ ID NO: 11), or NM_008663.2 (SEQ ID NO: 13), or a nucleotide sequence of 10-30 or 15-25 nucleotides capable of specifically hybridizing to an equal-length portion of the sequence of NCBI Reference Sequence NM_001256081.1 (SEQ ID NO: 7), NM_001256082.1 (SEQ ID NO: 9), NM_001256083.1 (SEQ ID NO: 11), or NM_008663.2 (SEQ ID NO: 13).

### Claim 12

The method of any preceding claim, wherein the gRNA comprises, consists essentially of, or consists of a nucleic acid sequence of, or capable of specifically binding to any one of the sequences of
(SEQ ID NO: 16)
GATGACGTTCATAGGCCGGTTGG,
(SEQ ID NO: 17)
CTTGCTCTCCTCATCGATGAGGG,
(SEQ ID NO: 18)
ATGAGGGAGATGACGTTCATAGG,
(SEQ ID NO: 19)
AGGGAGATGACGTTCATAGGCGG,
(SEQ ID NO: 20)
CAATCATGTCCAGTGCTTCCTGG,
(SEQ ID NO: 40)
GAUGACGUUCAUAGGCGGGU,
(SEQ ID NO: 41)
GACGUUCAUAGGCGGGU,
(SEQ ID NO: 42)
AGGGAGAUGACGUUCAUAGG,
(SEQ ID NO: 43)
GAGAUGACGUUCAUAGG,
(SEQ ID NO: 44)
CUUGCUCUCCUCAUCGAUGA,
or
(SEQ ID NO: 45)
AUGAGGGAGAUGACGUUCAU,
wherein each uracil base (U) may independently and optionally be replaced with a thymine base (T) and each T may independently and optionally be replaced with a U.

### Claim 13 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9)

The method of any one of claims 1-9, wherein the gRNA comprises, consists essentially of, or consists of a nucleotide sequence of 10-30 or 15-25 consecutive nucleotides of the sequence of NCBI Reference Sequence NM_000260.4 (SEQ ID NO: 1), NM_001127180.2 (SEQ ID NO: 3), or NM_001369365.1 (SEQ ID NO: 5) or a nucleotide sequence of 10-30 or 15-25 nucleotides capable of specifically hybridizing to an equal-length portion of the sequence of NCBI Reference Sequence NM_000260.4 (SEQ ID NO: 1), NM_001127180.2 (SEQ ID NO: 3), or NM_001369365.1 (SEQ ID NO: 5).

### Claim 14 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12)

The method of any one of claims 1-12, wherein the MYO7A gene is a mouse MYO7A gene.

### Claim 15 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 13)

The method of any one of claim 1-9 or 13, wherein the MYO7A gene is a human MYO7A gene.

### Claim 16

The method of any preceding claim, wherein the CRISPR-associated endonuclease, the gRNA, and/or the template nucleic acid are encapsulated within an extracellular vesicle.

### Claim 17 (depends on 16)

The method of claim 16, wherein the extracellular vesicle is an exosome.

### Claim 18 (depends on 16, 17)

The method of claim 16 or 17, wherein the extracellular vesicle is isolated or derived from an auditory cell, optionally wherein the auditory cell is an HEI-OC1 cell.

### Claim 19

A composition comprising a CRISPR-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease, a guide RNA (gRNA), and a template nucleic acid, wherein the gRNA is targets a MYO7A gene.

### Claim 20 (depends on 19)

The composition of claim 19, comprised within an extracellular vesicle.

### Claim 21 (depends on 20)

The composition of claim 20, wherein the extracellular vesicle is an exosome.

### Claim 22 (depends on 20, 21)

The composition of claim 20 or 21, wherein the extracellular vesicle is isolated or derived from an auditory cell, optionally wherein the auditory cell is an HEI-OC1 cell.

### Claim 23 (depends on 19, 20, 21, 22)

The composition of any one of claims 19-22, further comprising a stabilizing agent.

### Claim 24 (depends on 23)

The composition of claim 23, wherein the stabilizing agent is a disaccharide.

### Claim 25 (depends on 23, 24)

The composition of claim 23 or 24, wherein the stabilizing agent is trehalose.

### Claim 26 (depends on 20, 21, 22, 23, 24, 25)

The composition of any one of claims 20-25, wherein the stabilizing agent is associated with the extracellular vesicle.

### Claim 27 (depends on 19, 20, 21, 22, 23, 24, 25, 26)

The composition of any one of claims 19-26, wherein the CRISPR-associated endonuclease is Cas9.

### Claim 28 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27)

The composition of any one of claims 19-27, comprising a CRISPR-associated endonuclease.

### Claim 29 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27)

The composition of any one of claims 19-27, comprising a nucleic acid encoding a CRISPR-associated endonuclease.

### Claim 30 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29)

The composition of any one of claims 19-29, wherein the template nucleic acid comprises a portion of a nucleic acid sequence encoding a wild-type MYO7A protein.

### Claim 31 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30)

The composition of any one of claims 19-30, wherein the gRNA comprises, consists essentially of, or consists of a nucleic acid sequence of 10-30 or 15-25 consecutive nucleotides of the sequence of NCBI Reference Sequence NM_001256081.1 (SEQ ID NO: 7), NM_001256082.1 (SEQ ID NO: 9), NM_001256083.1 (SEQ ID NO: 11), or NM_008663.2 (SEQ ID NO: 13), or a nucleotide sequence of 10-30 or 15-25 nucleotides capable of specifically hybridizing to an equal-length portion of the sequence of NCBI Reference Sequence NM_001256081.1 (SEQ ID NO: 7), NM_001256082.1 (SEQ ID NO: 9), NM_001256083.1 (SEQ ID NO: 11), or NM_008663.2 (SEQ ID NO: 13).

### Claim 32 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31)

The composition of any one of claims 19-31, wherein the gRNA comprises, consists essentially of, or consists of a nucleic acid sequence of, or capable of specifically binding to any one of the sequences of
(SEQ ID NO: 16)
GATGACGTTCATAGGCCGGTTGG,
(SEQ ID NO: 17)
CTTGCTCTCCTCATCGATGAGGG,
(SEQ ID NO: 18)
ATGAGGGAGATGACGTTCATAGG,
(SEQ ID NO: 19)
AGGGAGATGACGTTCATAGGCGG,
(SEQ ID NO: 20)
CAATCATGTCCAGTGCTTCCTGG,
(SEQ ID NO: 40)
GAUGACGUUCAUAGGCGGGU,
(SEQ ID NO: 41)
GACGUUCAUAGGCGGGU,
(SEQ ID NO: 42)
AGGGAGAUGACGUUCAUAGG,
(SEQ ID NO: 43)
GAGAUGACGUUCAUAGG,
(SEQ ID NO: 44)
CUUGCUCUCCUCAUCGAUGA,
or
(SEQ ID NO: 45)
AUGAGGGAGAUGACGUUCAU,
wherein each uracil base (U) may independently and optionally be replaced with a thymine base (T) and each T may independently and optionally be replaced with a U.

### Claim 33 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30)

The composition of any one of claims 19-30, wherein the gRNA comprises, consists essentially of, or consists of a nucleotide sequence of 10-30 or 15-25 consecutive nucleotides of the sequence of NCBI Reference Sequence NM_000260.4 (SEQ ID NO: 1), NM_001127180.2 (SEQ ID NO: 3), or NM_001369365.1 (SEQ ID NO: 5) or a nucleotide sequence of 10-30 or 15-25 nucleotides capable of specifically hybridizing to an equal-length portion of the sequence of NCBI Reference Sequence NM_000260.4 (SEQ ID NO: 1), NM_001127180.2 (SEQ ID NO: 3), or NM_001369365.1 (SEQ ID NO: 5).

### Claim 34 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32)

The composition of any one of claims 19-32, wherein the MYO7A gene is a mouse MYO7A gene.

### Claim 35 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 33)

The composition of any one of claim 19-30 or 33, wherein the MYO7A gene is a human MYO7A gene.

### Claim 36 (depends on 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35)

A method of treating a hearing loss disorder, the method comprising administering to a subject in need thereof a composition of any one of claims 19-35 in an amount sufficient to treat a hearing loss disorder in the subject.

### Claim 37 (depends on 36)

The method of claim 36, wherein the subject is a mammal, optionally wherein the mammal is a primate.

### Claim 38 (depends on 36, 37)

The method of claim 36 or 37, wherein the subject is a human.