Methods and compositions for inhibiting expression of ldha
AssigneeNovo Nordisk Healthcare AG
InventorsBob D. BROWN, Henryk T. DUDEK, Utsav SAXENA, Natalie PURSELL, Cheng LAI, Weimin WANG, Rachel STORR, Naim NAZEF, Boyoung KIM
Life of this patent
Estimating the term…
Abstract
This disclosure relates to oligonucleotides, compositions and methods useful for reducing LDHA expression, particularly in hepatocytes.
Claims37
An oligonucleotide for reducing expression of LDHA, the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO:
- 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO:
- 2).
(canceled)
A composition having the chemical structure as depicted in FIG. 3.
(canceled)
(canceled)
(canceled)
(canceled)
An oligonucleotide for reducing expression of LDHA, the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO:
- 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO:
- 2), wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with a 2′-O-methyl, and all of positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with a 2′-fluoro;
- wherein the oligonucleotide has a phosphorothioate linkage between each of:
- positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand;
- wherein the oligonucleotide comprises the following structure at position 1 of the antisense strand:
- wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety comprising the structure:
Dependencies are inferred from the claim text.