Aavrh74 vectors for gene therapy of muscular dystrophies
AssigneeUniversity of Florida Research Foundation, Inc.
InventorsArun Srivastava, Keyun Qing, Barry John Byrne
Life of this patent
Estimating the term…
Abstract
Provided herein are modified AAV capsid proteins, particles, nucleic acid vectors, and compositions thereof, as well as methods of their use.
Claims42
A capsid protein comprising an amino acid substitution at a position corresponding to Y447, T494, K547, N665, and/or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:
- 1, wherein the capsid protein is an AAVrh74 serotype capsid protein,
- optionally wherein the substitution is Y447F, T494V, K547R, N665R, and/or Y733F.
A method comprising contacting a cell with a composition comprising an AAVrh74 particle, wherein the AAVrh74 particle comprises a capsid protein and a nucleic acid vector,
- (i) wherein the capsid protein comprises an amino acid substitution at a position corresponding to Y447, T494, K547, N665, and/or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:
- 1, optionally wherein the substitution is Y447F, T494V, K547R, N665R, and/or Y733F, and/or
- (ii) wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D-sequence and a second ITR comprising a second D-sequence, wherein the first D-sequence and/or the second D-sequence is substituted with an S-sequence, optionally wherein the S-sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO:
- 17)
A method comprising contacting a cell with a composition comprising an AAVrh74 particle, wherein the AAVrh74 particle comprises a capsid protein and a nucleic acid vector,
- (i) wherein the capsid protein comprises an amino acid substitution at a position corresponding to Y447, T494, K547, N665, and/or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:
- 1, optionally wherein the substitution is Y447F, T494V, K547R, N665R, and/or Y733F, and/or
- (ii) wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D-sequence and a second ITR comprising a second D-sequence, wherein the first D-sequence and/or the second D-sequence is substituted with a glucocorticoid receptor-binding element (GRE), optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO:
- 18), or its reverse or reverse complement, wherein each N is independently a T, C, G, or A.
Dependencies are inferred from the claim text.