Engineered guide rna for optimized crispr/cas12f1 (cas14a1) system and use thereof

A vector for a CRISPR/Cas12f1 (Cas14a1) system, comprising a nucleic acid encoding an engineered guide RNA,

• wherein the engineered guide RNA comprises an engineered trans-activating CRISPR RNA (tracrRNA) and a CRISPR RNA (crRNA),
• wherein the engineered tracrRNA is modified not to comprise a sequence of five or more consecutive uridines, and comprises a first sequence, a second sequence, a third sequence, a fourth sequence and a fifth sequence sequentially in a 3′ to 5′ direction,
• wherein the first sequence is 5′-CAAAUUCANNNVNCCUCUCCAAAUUCUGCACAA-3′ (SEQ ID NO:
• 194) or a part of SEQ ID NO:
• 194 wherein N is each independently A, C, G or U, and V is A, C or G, and the part of SEQ ID NO:
• 194 is a sequence that comprises 5′-CAAAUUCANNNVN-3′ (SEQ ID NO:
• 193) and does not comprise at least one nucleotide from the 3′ end of SEQ ID NO:
• 194,
• the second sequence is 5′-AUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAA-3′ (SEQ ID NO:
• 211) or a sequence having sequence identity or sequence similarity of at least 70% or more to SEQ ID NO:
• 211,
• the third sequence is 5′-GGCUGCUUGCAUCAGCCUA-3′ (SEQ ID NO:
• 212) or a sequence having sequence identity or sequence similarity of at least 70% or more to SEQ ID NO:
• 212,
• the fourth sequence is 5′-CCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGU G-3′ (SEQ ID NO:
• 213) or a part of SEQ ID NO:
• 213 wherein the part of SEQ ID NO:
• 213 is a sequence obtained by deleting at least one pair of nucleotides forming a complementary base pair and/or at least one nucleotide not involved in forming a complementary base pair from SEQ ID NO:
• 213, and
• the fifth sequence is 5′-CUUCACUGAUAAAGUGGAGAA-3′ (SEQ ID NO:
• 248) or a part of SEQ ID NO:
• 248 wherein the part of SEQ ID NO:
• 248 is a sequential partial sequence at the 3′ end of SEQ ID NO:
• 248;
• and
• the crRNA is a wildtype crRNA or an engineered crRNA,
• wherein the wildtype crRNA comprises a wildtype repeat sequence and a guide sequence sequentially in a 5′ to 3′ direction, and
• the engineered crRNA comprises a sixth sequence, a seventh sequence and a guide sequence sequentially in a 5′ to 3′ direction,
• wherein the sixth sequence is 5′-GUUGCAGAACCCGAAUAGNBNNNUGAAGGA-3′ (SEQ ID NO:
• 373) or a part of SEQ ID NO:
• 373, wherein N is each independently A, C, G or U, and B is U, C or G;
• and the part of SEQ ID NO:
• 373 is a sequence that comprises 5′-NBNNNUGAAGGA-3′ (SEQ ID NO:
• 372) and does not comprise at least one nucleotide from the 3′ end of SEQ ID NO:
• 373,
• the seventh sequence is 5′-AUGCAAC-3′ or a sequence having sequence identity or sequence similarity of at least 70% or more to 5′-AUGCAAC-3′, and
• the guide sequence is a sequence capable of hybridizing with a target sequence or a sequence forming a complementary bond to the target sequence, and has 15 to 30 nucleotides (nts).

A composition comprising an engineered CRISPR/Cas12f1 (Cas14a1) system,

• wherein the engineered CRISPR/Cas12f1 (Cas14a1) system comprises:
• an engineered guide RNA or a nucleic acid encoding the engineered guide RNA;
• and
• a Cas12f1 (Cas14a1) protein or a nucleic acid encoding the Cas12f1 protein,
• wherein the engineered guide RNA comprises an engineered trans-activating CRISPR RNA (tracrRNA) and a CRISPR RNA (crRNA),
• wherein the engineered tracrRNA is modified not to comprise a sequence of five or more consecutive uridines, and comprises a first sequence, a second sequence, a third sequence, a fourth sequence and a fifth sequence sequentially in a 3′ to 5′ direction,
• wherein the first sequence is 5′-CAAAUUCANNNVNCCUCUCCAAAUUCUGCACAA-3′ (SEQ ID NO:
• 194) or a part of SEQ ID NO:
• 194, wherein N is each independently A, C, G or U, and V is A, C or G;
• and the part of SEQ ID NO:
• 194 is a sequence that comprises 5′-CAAAUUCANNNVN-3′ (SEQ ID NO:
• 193) and does not comprise at least one nucleotide from the 3′ end of SEQ ID NO:
• 194,
• the second sequence is 5′-AUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAA-3′ (SEQ ID NO:
• 211) or a sequence having sequence identity or sequence similarity of at least 70% or more to SEQ ID NO:
• 211,
• the third sequence is 5′-GGCUGCUUGCAUCAGCCUA-3′ (SEQ ID NO:
• 212) or a sequence having sequence identity or sequence similarity of at least 70% or more to SEQ ID NO:
• 212,
• the fourth sequence is 5′-CCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGU G-3′ (SEQ ID NO:
• 213) or a part of SEQ ID NO:
• 213, wherein the part of SEQ ID NO:
• 213 is a sequence obtained by deleting at least one pair of nucleotides forming a complementary base pair and/or at least one nucleotide not involved in forming a complementary base pair from SEQ ID NO:
• 213, and
• the fifth sequence is 5′-CUUCACUGAUAAAGUGGAGAA-3′ (SEQ ID NO:
• 248) or a part of SEQ ID NO:
• 248, wherein the part of SEQ ID NO:
• 248 is a sequential partial sequence at the 3′ end of SEQ ID NO:
• 248;
• and
• the crRNA is a wildtype crRNA or an engineered crRNA,
• wherein the wildtype crRNA comprises a wildtype repeat sequence and a guide sequence sequentially in a 5′ to 3′ direction, and
• the engineered crRNA comprises a sixth sequence, a seventh sequence and a guide sequence sequentially in a 5′ to 3′ direction,
• wherein the sixth sequence is 5′-GUUGCAGAACCCGAAUAGNBNNNUGAAGGA-3′ (SEQ ID NO:
• 373) or a part of SEQ ID NO:
• 373, wherein N is each independently A, C, G or U, and B is U, C or G;
• and the part of SEQ ID NO:
• 373 is a sequence that comprises 5′-NBNNNUGAAGGA-3′ (SEQ ID NO:
• 372) and does not comprise at least one nucleotide from the 3′ end of SEQ ID NO:
• 373,
• the seventh sequence is 5′-AUGCAAC-3′ or a sequence having sequence identity or sequence similarity of at least 70% or more to 5′-AUGCAAC-3′, and
• the guide sequence is a sequence capable of hybridizing with a target sequence or a sequence forming a complementary bond to the target sequence, and is a sequence of 15 to 30 nucleotides (nts).