Chemical modifications for inhibiting expression of aldh2
AssigneeDicerna Pharmaceuticals, Inc.
InventorsBob Dale BROWN, Henryk T. DUDEK, Utsav SAXENA
Life of this patent
Estimating the term…
Abstract
This disclosure relates to chemically modified oligonucleotides, compositions, and methods useful for reducing ALDH2 expression, to treat alcoholism. Disclosed oligonucleotide for the reduction of ALDH2 expression is modified for enhanced pharmacological properties.
Claims22
An oligonucleotide for reducing expression of ALDH2, the oligonucleotide comprising an antisense strand comprising an antisense strand having a sequence from 5′ to 3′ set forth as UAAACUGAGUUUCAUCCACCGG (SEQ ID NO:
- 1) and a sense strand having a sequence from 5′ to 3′ set forth as GGUGGAUGAAACUCAGUUUAGCAGCCGAAAGGCUGC (SEQ ID NO:
- 2);
- or a pharmaceutically acceptable salt thereof.
A double stranded oligonucleotide comprising a sense strand:
- 5′mG-S-mG-mU-mG-mG-mA-mU-fG-fA-fA-fA-mC-mU-mC-mA-mG-mU-mU-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC 3′ (SEQ ID NO:
- 3), and
- an antisense strand:
- 5′ [MePhosphonate-4O-mU]-S-fA-S-fA-S-fA-fC-mU-fG-mA-mG-mU-mU-mU-mC-fA-mU-mC-mC-mA-mC-mC-S-mG-S-mG 3′ (SEQ ID NO:
- 6);
- or a pharmaceutically acceptable salt thereof,
- wherein:
- “-” between nucleosides represent a phosphodiester internucleoside linkage;
- “—S—” between nucleosides represent a phosphorothioate internucleoside linkage;
- mA represents 2′-O-methyladenosine ribonucleoside;
- mG represents 2′-O-methylguanosine ribonucleoside;
- mC represents 2′-O-methylcytidine ribonucleoside;
- mU represents 2′-O-methyluridine ribonucleoside;
- fA represents 2′-fluoro-adenosine deoxyribonucleoside;
- fG represents 2′-fluoro-guanosine deoxyribonucleoside;
- fC represents 2′-fluoro-cytidine deoxyribonucleoside;
- fU represents 2′-fluoro-uridine deoxyribonucleoside;
- [ademA-GalNAc] represents
- and
- [MePhosphonate-4O-mU] represents
A sodium salt of a double stranded oligonucleotide comprising a sense strand:
- 5′ mG-S-mG-mU-mG-mG-mA-mU-fG-fA-fA-fA-mC-mU-mC-mA-mG-mU-mU-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC 3′ (SEQ ID NO:
- 3), and
- an antisense strand:
- 5′ [MePhosphonate-4O-mU]-S-fA-S-fA-S-fA-fC-mU-fG-mA-mG-mU-mU-mU-mC-fA-mU-mC-mC-mA-mC-mC-S-mG-S-mG 3′ (SEQ ID NO:
- 6),
- wherein:
- “-” between nucleosides represent a phosphodiester internucleoside linkage;
- “—S—” between nucleosides represent a phosphorothioate internucleoside linkage;
- mA represents 2′-O-methyladenosine ribonucleoside;
- mG represents 2′-O-methylguanosine ribonucleoside;
- mC represents 2′-O-methylcytidine ribonucleoside;
- mU represents 2′-O-methyluridine ribonucleoside;
- fA represents 2′-fluoro-adenosine deoxyribonucleoside;
- fG represents 2′-fluoro-guanosine deoxyribonucleoside;
- fC represents 2′-fluoro-cytidine deoxyribonucleoside;
- fU represents 2′-fluoro-uridine deoxyribonucleoside;
- [ademA-GalNAc] represents
- and
- [MePhosphonate-4O-mU] represents
A composition comprising a double stranded oligonucleotide, wherein the double stranded oligonucleotide comprises a sense strand:
- 5′ mG-S-mG-mU-mG-mG-mA-mU-fG-fA-fA-fA-mC-mU-mC-mA-mG-mU-mU-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC 3′(SEQ ID NO:
- 3), and
- an antisense strand:
- 5′ [MePhosphonate-4O-mU]-S-fA-S-fA-S-fA-fC-mU-fG-mA-mG-mU-mU-mU-mC-fA-mU-mC-mC-mA-mC-mC-S-mG-S-mG 3′ (SEQ ID NO:
- 6);
- or a pharmaceutically acceptable salt thereof,
- wherein:
- “-” between nucleosides represent a phosphodiester internucleoside linkage;
- “—S—” between nucleosides represent a phosphorothioate internucleoside linkage;
- mA represents 2′-O-methyladenosine ribonucleoside;
- mG represents 2′-O-methylguanosine ribonucleoside;
- mC represents 2′-O-methylcytidine ribonucleoside;
- mU represents 2′-O-methyluridine ribonucleoside;
- fA represents 2′-fluoro-adenosine deoxyribonucleoside;
- fG represents 2′-fluoro-guanosine deoxyribonucleoside;
- fC represents 2′-fluoro-cytidine deoxyribonucleoside;
- fU represents 2′-fluoro-uridine deoxyribonucleoside;
- [ademA-GalNAc] represents
- and
- [MePhosphonate-4O-mU] represents
Dependencies are inferred from the claim text.