Molecular diagnostic kit for detecting nucleotide sequences and methods for detecting infectious agents using said kit

A molecular-based diagnostic kit for detecting in biological samples the presence of nucleotide sequences of Trypanosoma cruzi, an agent causing the Chagas disease, specially designed to be used at “point-of-care” (POC) diagnostic centers, said kit comprising:

• a first vial with an anti-contamination system that contains a solution of the polymerase enzyme, saline components, chaotropic agents and deoxyribonucleotides, wherein the polymerase enzyme is selected from the BST enzyme family, which consists of DNA polymerase/helicase, with no exonuclease activity;
• optionally, a second vial with an anti-contamination system that contains a set of at least 4 primers, with at least part of its sequences being preserved in the nucleic acid fragment to be detected, wherein the set of primers is selected from the genome sequences or fragment to be detected, whether of deoxyribonucleic or ribonucleic nature;
• a container to hold the sample to be tested, selected from a reaction tube and a reaction tray, wherein said container can hold in its interior a sample optionally on a carrier and reagents, be closed and heated so that the reaction takes place during an incubation time;
• once the incubation time is completed, at least a developing system by LFD dipstick (“Lateral Flow Dipsticks”) or, alternatively, by change of indicating dye;
• and
• positive and negative controls;
• said diagnostic kit CHARACTERIZED in that:
• the set of at least 4 primers comprises SAT gene sequences selected from:
• F3-ACAGAGAGTGCCTCTGA,
• B3- GTCAATATCTGTTTGCG,
• FIP-CACTCGGCTGATCGTTTTCGACCCCCATCATTCATAATTGGA,
• BIP-GGCAAGAGCTCGCGAAATTCCACACACTGGACACCAAA,
• Lb-TCCAAGCAGCGGATAATTCA,
• and
• Lf-TGCATCACATGTTGTGGTCTA;
• and
• wherein the vials are calibrated dropper bottles with an anti-contamination system.

A molecular-based diagnostic kit for detecting in biological samples the presence of SARS-CoV-2, an agent causing COVID-19, specially designed to be used at “point-of-care” (POC) diagnostic centers, said kit comprising:

• a first vial with an anti-contamination system, containing a solution of the polymerase enzyme, a reverse transcriptase, saline components, chaotropic agents and deoxyribonucleotides, wherein the polymerase enzyme is selected from the BST enzyme family, which consists of DNA polymerase/helicase, with no exonuclease activity, and
• optionally, a second vial having a set of at least 4 primers, with at least part of its sequences being preserved in the nucleic acid fragment to be detected, wherein the set of primers is selected from the genome sequences or fragment to be detected, whether of deoxyribonucleic or ribonucleic nature;
• a container to hold the sample to be tested, selected from a reaction tube and a reaction tray, wherein said container can hold in its interior a sample optionally on a carrier and reagents, be closed and heated so that the reaction takes place during an incubation time;
• once the incubation time is completed, at least a developing system by LFD dipstick (“Lateral Flow Dipsticks”) or, alternatively, by change of indicating dye;
• and
• positive and negative controls;
• said diagnostic kit CHARACTERIZED in that:
• the set of at least 4 primers comprises:
• R1Aa2 sequences selected from:
• F3-TGCTTGTGAAATTGTCGGT,
• B3-GCCAGTTTCTTCTCTGGAT,
• FIP-TCAGCACACAAAGCCAAAAATTTATAAATTGTCACCTGTGCAAAG,
• BIP-TATTGGTGGAGCTAAACTTAAAGCCACACTTTCTGTACAATCCCT
• T,
• Lb-GAATTTAGGTGAAACATTTGTCACG,
• and
• Lf- CTTAAAGAATGTCTGAACACTCTCC,
• and
• pE-2 sequences selected from:
• F3-CCGACGACGACTACTAGC,
• B3-GACTCACGTTAACAATATTGCA,
• FIP-ACTATTAACGTACCTGTCTCTTCCGGTGCCTTTGTAAGCACAAG,
• BIP-AGCGTACTTCTTTTTCTTGCTTTCGCAGTACGCACACAATCGA,
• Lb-CTTGCTAGTTACACTAGCCATCCT,
• and
• Lf- CGAATGAGTACATAAGTTCGTACTC;
• and
• wherein the vials are calibrated dropper bottles with an anti-contamination system.