# US 2023/0056099 A1 · Thrombin Binding Circular Aptamer and Use Thereof

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2023/0056099 A1
- Document ID: US20230056099A1
- Status: Published application
- Kind: A1
- Application number: 17/624,257
- Filed: 2020-01-22
- Published: 2023-02-23
- Earliest claimed: 2019-07-03
- Assignees: Hefei University of Technology
- Applicants: Hefei University of Technology
- Inventors: Lei Zheng; Yu Mao
- Web page: https://patentgrep.com/patent/US20230056099A1

## CPC

- C12N 15/115: Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith {; Nucleic acids binding to non-nucleic acids, e.g. aptamers}
- C12N 2310/16: Aptamers
- C12N 2310/532: Closed or circular
- C12N 2320/30: Special therapeutic applications
- C12N 2320/52: modulating the physical stability, e.g. GC-content
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

Provided is a thrombin binding circular aptamer, the nucleotide sequence thereof being at least one selected from a) to e): a) a nucleotide sequence in SEQ ID NO:1, wherein the 5′ end and 3′ end are connected to form a ring; b) a nucleotide sequence obtained by substitution in the nucleotide sequence in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin; c) a nucleotide sequence obtained by deletion in the nucleotide sequence in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin; d) a nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence in SEQ ID NO:1; and e) a nucleotide sequence obtained by modification of the nucleotide sequence in SEQ ID NO:1 with a chemical group.

## Claims

### Claim 1

A thrombin binding circular aptamer, characterized in that, the thrombin binding circular aptamer has a nucleotide sequence of at least one selected from a) to e):
a) a nucleotide sequence as shown in SEQ ID NO:1, wherein the 5′ end and 3′ end are connected to form a ring, the nucleotide sequence as shown in SEQ ID NO:1 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGT
TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′;
b) a nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the SEQ ID NO:1;
c) a nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 has over 70% homology with the nucleotide sequence as shown in SEQ ID NO:1;
d) a nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the nucleotide sequence as shown in SEQ ID NO:1;
e) a nucleotide sequence obtained by modification of the nucleotide sequence as shown in SEQ ID NO:1 with a chemical group.

### Claim 2 (depends on 1)

The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 has over 90% homology with the SEQ ID NO:1.

### Claim 3 (depends on 1)

The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 comprises at least one from b1) to b5):
b1) a nucleotide sequence as shown in SEQ ID NO:3, the nucleotide sequence as shown in SEQ ID NO:3 being
5′-NNNNNNNCTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGT
TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′;
b2) a nucleotide sequence as shown in SEQ ID NO:4, the nucleotide sequence as shown in SEQ ID NO:4 being
5′-ATCTCGANNNNNNNTAGGGGGCGCGAACATACGCGGTTGGTGTGGT
TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′;
b3) a nucleotide sequence as shown in SEQ ID NO:5, the nucleotide sequence as shown in SEQ ID NO:5 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT
GGCTGACAANNNNNNNTTTTGGTGTCTCGGAT-3′;
b4) a nucleotide sequence as shown in SEQ ID NO:6, the nucleotide sequence as shown in SEQ ID NO:6 being 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTGGCTGACA ATACTCGTNNNNNNNGTCTCGGAT-3′;
b5) a nucleotide sequence as shown in SEQ ID NO:7, the nucleotide sequence as shown in SEQ ID NO:7 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT
GGCTGACAATACTCGTTTTTGGTNNNNNNNNN-3′;
wherein, N represents at least one from A, T, C and G.

### Claim 4 (depends on 3)

The thrombin binding circular aptamer according to claim 3, characterized in that, the N represents T and/or A.

### Claim 5 (depends on 1)

The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the SEQ ID NO:1.

### Claim 6 (depends on 1)

The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 comprises at least one from c1) to c3):
c1) a nucleotide sequence as shown in SEQ ID NO:8, the nucleotide sequence as shown in SEQ ID NO:8 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT
GGCTGACAATACTCGTGTCTCGGAT-3′;
c2) a nucleotide sequence as shown in SEQ ID NO:9, the nucleotide sequence as shown in SEQ ID NO:9 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT
GGCTGACAATACTCGT-3′;
c3) a nucleotide sequence as shown in SEQ ID NO:10, the nucleotide sequence as shown in SEQ ID NO:10 being
5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTG
GCTGACAA-3′.

### Claim 7 (depends on 1)

The thrombin binding circular aptamer according to claim 1, characterized in that, the chemical group comprises: —NH2 or —F modified at the 2′-position of a pyrimidine ring, —OCH3 modified at the 2′-position of a purine ring, a phosphorothioate radical modified between adjacent nucleotides, and a pyrimidine analogue modified at the 5′-endpoint.

### Claim 8 (depends on 1)

A use of the thrombin binding circular aptamer according to claim 1 in preparation of thrombin inhibitors.

### Claim 9 (depends on 1)

A use of the thrombin binding circular aptamer according to claim 1 in preparation of drug products for prevention and/or treatment of diseases associated with thrombin.