# US 2023/0054569 A1 · Compositions and methods for treating retinitis pigmentosa

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2023/0054569 A1
- Document ID: US20230054569A1
- Status: Published application
- Kind: A1
- Application number: 17/786,849
- Filed: 2020-12-17
- Published: 2023-02-23
- Earliest claimed: 2019-12-18
- Assignees: Alia Therapeutics Srl
- Applicants: Alia Therapeutics Srl
- Inventors: Antonio Casini; Laura Pezzè; Kalina Badowska
- Web page: https://patentgrep.com/patent/US20230054569A1

## CPC

- A61K 31/7088: Compounds having three or more nucleosides or nucleotides
- C12N 15/102: {Mutagenizing nucleic acids}
- C12N 15/1138: {against receptors or cell surface proteins}
- C12N 15/8645: {Adeno-associated virus}
- C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR]
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

Compositions and methods useful for altering a P347 mutation in a RHO gene.

## Claims

### Claim 1

A guide RNA molecule (gRNA) for editing a human RHO gene having a P347 mutation.

### Claim 2 (depends on 1)

The gRNA of claim 1, wherein the P347 mutation is a P347L mutation, a P347S mutation, a P347R mutation, a P347Q mutation, a P347T mutation, or a P347A mutation.

### Claim 3 (depends on 2)

The gRNA of claim 2, wherein the P347 mutation is a P347L mutation.

### Claim 4 (depends on 1, 2, 3)

The gRNA of any one of claims 1 to 3, wherein upon introduction of the gRNA and a DNA endonuclease capable of associating with the gRNA into a human cell containing a human RHO gene having a P347 mutation, the DNA endonuclease cleaves the RHO gene having a P347 mutation.

### Claim 5 (depends on 1, 2, 3, 4)

The gRNA of any one of claims 1 to 4, wherein upon introduction of the gRNA and a DNA endonuclease capable of associating with the gRNA into a human cell containing a human RHO gene having a P347 mutation and containing a human RHO gene not having a P347 mutation or into a population of human cells each containing a human RHO gene having a P347 mutation and containing a human RHO gene not having a P347 mutation, indels in the human RHO gene not having a P347 mutation occur with a frequency of less than 20%.

### Claim 6 (depends on 1, 2, 3, 4, 5)

The gRNA of any one of claims 1 to 5, which comprises a spacer that is 15 to 30 nucleotides in length.

### Claim 7 (depends on 6)

The gRNA of claim 6, wherein the nucleotide sequence of the spacer comprises 15 or more consecutive nucleotides of a reference sequence or comprises a nucleotide sequence that is at least 85% identical to a reference sequence, wherein the reference sequence is:
(SEQ ID NO: 5)
a) GGUCUUAGGCCAGGGCCACC;
(SEQ ID NO: 6)
b) GCCCUGGCCUAAGACCUGCCU;
(SEQ ID NO: 7)
c) CCUAGGCAGGUCUUAGGCCA;
(SEQ ID NO: 8)
d) gCCUAGGCAGGUCUUAGGCCA;
(SEQ ID NO: 9)
e) GACGAGCCAGGUGGCCCUGGCCU;
(SEQ ID NO: 10)
f) GUCCUAGGCAGGUCUUAGGCCAGG;
(SEQ ID NO: 11)
g) UUAGGCCAGGGCCACCUGGCUC;
or
(SEQ ID NO: 12)
h) GCCAGGUGGCCCUGGCCUAAGA.

### Claim 8

A guide RNA molecule (gRNA) comprising a spacer whose nucleic acid sequence comprises 15 or more consecutive nucleotides from a reference sequence or comprises a nucleotide sequence that is at least 85% identical to a reference sequence, wherein the reference sequence is:
(SEQ ID NO: 5)
a) GGUCUUAGGCCAGGGCCACC;
(SEQ ID NO: 6)
b) GCCCUGGCCUAAGACCUGCCU;
(SEQ ID NO: 7)
c) CCUAGGCAGGUCUUAGGCCA;
(SEQ ID NO: 8)
d) gCCUAGGCAGGUCUUAGGCCA;
(SEQ ID NO: 9)
e) GACGAGCCAGGUGGCCCUGGCCU;
(SEQ ID NO: 10)
f) GUCCUAGGCAGGUCUUAGGCCAGG;
(SEQ ID NO: 11)
g) UUAGGCCAGGGCCACCUGGCUC;
or
(SEQ ID NO: 12)
h) GCCAGGUGGCCCUGGCCUAAGA.

### Claim 9 (depends on 7, 8)

The gRNA molecule of claim 7 or claim 8, wherein the nucleotide sequence of the spacer comprises a sequence that is identical to the reference sequence.

### Claim 10 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is GGUCUUAGGCCAGGGCCACC (SEQ ID NO:5).

### Claim 11 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is GCCCUGGCCUAAGACCUGCCU (SEQ ID NO:6).

### Claim 12 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is CCUAGGCAGGUCUUAGGCCA (SEQ ID NO:7).

### Claim 13 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is gCCUAGGCAGGUCUUAGGCCA (SEQ ID NO:8).

### Claim 14 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is GACGAGCCAGGUGGCCCUGGCCU (SEQ ID NO:9).

### Claim 15 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is GUCCUAGGCAGGUCUUAGGCCAGG (SEQ ID NO:10).

### Claim 16 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is UUAGGCCAGGGCCACCUGGCUC (SEQ ID NO:11).

### Claim 17 (depends on 7, 8, 9)

The gRNA molecule of any one of claims 7 to 9, wherein the reference sequence is GCCAGGUGGCCCUGGCCUAAGA (SEQ ID NO:12).

### Claim 18 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17)

The gRNA molecule of any one of claims 1 to 17, which is a Cas9 gRNA.

### Claim 19 (depends on 18)

The gRNA molecule of claim 18, which is a Streptococcus pyogenes Cas9 (SpCas9) gRNA.

### Claim 20 (depends on 18)

The gRNA molecule of claim 18, which is a Neisseria meningitidis Cas9 gRNA.

### Claim 21 (depends on 20)

The gRNA molecule of claim 20, which is a Nme2Cas9 gRNA.

### Claim 22 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21)

The gRNA molecule of any one of claims 1 to 21, which is a single guide RNA (sg RNA).

### Claim 23 (depends on 22)

The gRNA molecule of claim 22, which comprises a 3′ sgRNA segment.

### Claim 24 (depends on 23)

The gRNA molecule of claim 23, wherein the 3′ sgRNA segment has a nucleotide sequence comprising a sequence set forth in Table 3 or Table 4.

### Claim 25 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 8 as set forth in Table 3

### Claim 26 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 14 as set forth in Table 3.

### Claim 27 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 29 as set forth in Table 3.

### Claim 28 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 31 as set forth in Table 3.

### Claim 29 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 7 as set forth in Table 4.

### Claim 30 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 20 as set forth in Table 4.

### Claim 31 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 21 as set forth in Table 4.

### Claim 32 (depends on 24)

The gRNA of claim 24, wherein the 3′ sgRNA segment comprises the nucleotide sequence of 3′ sgRNA sequence 22 as set forth in Table 4.

### Claim 33 (depends on 23, 24, 25, 26, 27, 28, 29, 30, 31, 32)

The gRNA of any one of claims 23 to 32, wherein the 3′ sgRNA segment comprises one or more uracils at its 3′ end.

### Claim 34 (depends on 33)

The gRNA of claim 33, wherein the 3′ sgRNA segment comprises one to eight uracils at its 3′ end.

### Claim 35 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34)

The gRNA of any one of claims 1 to 34, wherein the gRNA is an unmodified gRNA.

### Claim 36 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35)

A nucleic acid encoding the gRNA of any one of claims 1 to 35.

### Claim 37 (depends on 36)

The nucleic acid of claim 36, which further comprises a Pol III promoter sequence operably linked to the nucleotide sequence encoding the gRNA, optionally wherein the promoter is a U6 or H1 promoter.

### Claim 38 (depends on 36, 37)

The nucleic acid of claim 36 or claim 37, which further encodes a second gRNA.

### Claim 39 (depends on 38)

The nucleic acid of claim 38, wherein the second gRNA is a sgRNA.

### Claim 40 (depends on 38, 39)

The nucleic acid of claim 38 or claim 39, wherein the second gRNA comprises a spacer sequence that is partially or fully complementary to a target sequence in intron 4 of a human RHO gene.

### Claim 41 (depends on 40)

The nucleic acid of claim 40, wherein the spacer sequence of the second gRNA comprises the spacer sequence of sg-Int39, sg-Int103, or sg-Int153 as set forth in Table 13.

### Claim 42 (depends on 36, 37, 38, 39, 40, 41)

The nucleic acid of any one of claims 36 to 41, which further encodes a Cas9 protein.

### Claim 43 (depends on 42)

The nucleic acid of claim 42, which further comprises a promoter sequence operably linked to the nucleotide sequence encoding the Cas9 protein, optionally wherein the promoter sequence is (a) a tissue-specific promoter, which is optionally a RHO promoter or a hGRK1 promoter, or (b) a constitutive promoter, which is optionally an EF1 alpha promoter, which is optionally an EF1 alpha short (EFS) promoter.

### Claim 44 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43)

A plurality of nucleic acids comprising (a) the gRNA of any one of claims 1 to 35 or the nucleic acid of any one of claims 36 to 43, and (b) a nucleic acid encoding a Cas9 protein.

### Claim 45 (depends on 44)

The plurality of nucleic acids of claim 44, further comprising a nucleic acid encoding a second gRNA, optionally wherein the second gRNA comprises a spacer sequence that is partially or fully complementary to a target sequence in intron 4 of a human RHO gene.

### Claim 46 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45)

A particle comprising the gRNA of any one of claims 1 to 35, the nucleic acid of any one of claims 36 to 43, or the plurality of nucleic acids of claim 44 or claim 45.

### Claim 47 (depends on 46)

The particle of claim 46, which further comprises a Cas9 protein or a nucleic acid encoding a Cas9 protein.

### Claim 48 (depends on 36, 37, 38, 39, 40, 41, 42, 43)

A particle comprising the nucleic acid of any one of claims 36 to 43, wherein the particle is a viral particle.

### Claim 49 (depends on 48)

The particle of claim 48, which is an adeno-associated virus (AAV) particle, optionally wherein the particle is a AAV2 particle, a AAV5 particle, a AAV7m8 particle or a AAV8 particle.

### Claim 50 (depends on 48, 49)

The particle of any one of claims 48 to 49, which comprises a nucleic acid encoding a Cas9 protein.

### Claim 51 (depends on 50)

The particle of claim 50, wherein the nucleic acid encoding the Cas9 protein further comprises a promoter sequence operably linked to the nucleotide sequence encoding the Cas9 protein, optionally wherein the promoter sequence is (a) a tissue-specific promoter, which is optionally a RHO promoter or a hGRK1 promoter, or (b) a constitutive promoter, which is optionally an EF1 alpha promoter, which is optionally an EF1 alpha short (EFS) promoter

### Claim 52 (depends on 48, 49)

A plurality of particles comprising the particle of any one of claims 48 to 49 and a particle comprising a nucleic acid encoding a Cas9 protein.

### Claim 53 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35)

A system comprising a Cas9 protein and a gRNA of any one of claims 1 to 35.

### Claim 54 (depends on 53)

The system of claim 53, further comprising a second gRNA, optionally wherein the second gRNA comprises a spacer sequence that is partially or fully complementary to a target sequence in intron 4 of a human RHO gene.

### Claim 55 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53)

A pharmaceutical composition comprising (i) the gRNA of any one of claims 1 to 35, the nucleic acid of any one of claims 36 to 43, the plurality of nucleic acids of any one of claims 44 to 45, the particle of any one of claims 46 to 51, the plurality of particles of claim 52, or the system of claim 53 and (ii) a pharmaceutically acceptable excipient.

### Claim 56 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54)

A cell comprising the gRNA of any one of claims 1 to 35, the nucleic acid of any one of claims 36 to 43, the plurality of nucleic acids of any one of claims 44 to 45, the particle of any one of claims 46 to 51, the plurality of particles of claim 52, or the system of any one of claims 53 to 54.

### Claim 57 (depends on 56)

The cell of claim 56, which is a human cell, which is optionally a human retinal cell, a human retinal epithelial cell, a human photoreceptor cell, a human retinal progenitor cell, a stem cell, an iPS cell, a HEK293T cell, or a HEK293T/17 cell, and optionally wherein the cell is an ex vivo cell.

### Claim 58 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55)

The gRNA of any one of claims 1 to 35, the nucleic acid of any one of claims 36 to 43, the plurality of nucleic acids of any one of claims 44 to 45, the particle of any one of claims 46 to 51, the plurality of particles of claim 52, or the system of any one of claims 53 to 54 or the pharmaceutical composition of claim 55 for use in a method of altering a human cell comprising a RHO gene having a P347 mutation.

### Claim 59 (depends on 58)

The gRNA for use, nucleic acid for use, plurality of nucleic acids for use, the particle for use, the plurality of particles for use, the system for use, or pharmaceutical composition for use according to claim 58, wherein the P347 mutation is a P347L mutation, a P347S mutation, a P347R mutation, a P347Q mutation, a P347T mutation, or a P347A mutation.

### Claim 60 (depends on 59)

The gRNA for use, nucleic acid for use, plurality of nucleic acids for use, the particle for use, the plurality of particles for use, the system for use, or pharmaceutical composition for use according to claim 59, wherein the P347 mutation is a P347L mutation.