# US 2023/0053353 A1 · Targeting transfer rna for the suppression of nonsense mutations in messenger rna

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2023/0053353 A1
- Document ID: US20230053353A1
- Status: Published application
- Kind: A1
- Application number: 17/791,498
- Filed: 2021-01-08
- Published: 2023-02-23
- Earliest claimed: 2020-01-09
- Assignees: The Regents of the University of California
- Applicants: The Regents of the University of California
- Inventors: Prashant Mali; Dhruva Katrekar; Thomas Morton
- Web page: https://patentgrep.com/patent/US20230053353A1

## CPC

- C12N 15/11: DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity}
- C12N 15/1024: {In vivo mutagenesis using high mutation rate "mutator" host strains by inserting genetic material, e.g. encoding an error prone polymerase, disrupting a gene for mismatch repair}
- C12N 15/63: Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N 2310/122: Hairpin
- C12N 2310/16: Aptamers
- C12N 2310/3519: Fusion with another nucleic acid
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

The disclosure provides for a targeting transfer RNA (ttRNA) that that suppresses nonsense mutations in messenger RNA, that comprises an anticodon sequence that binds to a stop codon and a variable loop sequence that comprises an RNA aptamer that has strong binding affinity to an RNA binding protein; and methods of use thereof.

## Claims

### Claim 1

A targeting transfer RNA (ttRNA) comprising:
a polynucleotide having a general structure from 5′ to 3′ of: 5′-(D-Loop domain)-(anticodon loop domain)-(variable loop domain)-(T loop domain)-3′,
wherein the anticodon loop domain comprises a sequence selected from N1UCTAN2N3; N1UUUAN2N3; or N1UUCAN2N3, wherein N1 is a pyrimidine, N2 is a purine and N3 is any of U, A or C, that binds to a stop codon sequence of an mRNA,
wherein the variable loop domain is at least about 12 to about 30 nucleotides in length and which comprises a sequence that is selectively bound by a protein or an agent tag, and
wherein the ttRNA at least partially suppresses nonsense mutations in messenger RNA.

### Claim 2 (depends on 1)

The ttRNA of claim 1, wherein the variable loop is from 12 to 30 nucleotides in length.

### Claim 3 (depends on 1)

The ttRNA of claim 1, wherein the ttRNA comprises a nucleic acid sequence that binds with an RNA binding protein.

### Claim 4 (depends on 1, 3)

The ttRNA of claim 1 or claim 3, wherein the polynucleotide is engineered from a tRNA for an amino acid selected from the group consisting of alanine, asparagine, aspartic acid, arginine, cysteine, glutamine, glycine, glutamic acid, histidine, isoleucine, lysine, leucine, phenylalanine, proline, methionine, serine, tryptophan, threonine, tyrosine, and valine.

### Claim 5

The ttRNA of any one of the preceding claims, wherein the polynucleotide is engineered from a tRNA for serine or arginine.

### Claim 6 (depends on 4, 5)

The ttRNA of claim 4 or claim 5, wherein the tRNA is a tRNA gene found in a human genome.

### Claim 7

The ttRNA of any one of the preceding claims, wherein the ttRNA has a cloverleaf-like structure.

### Claim 8

The ttRNA of any one of the preceding claims, wherein the D-Loop domain and T-Loop domain of the polynucleotide comprises a naturally occurring sequence from a human tRNA.

### Claim 9

The ttRNA of any one of the preceding claims, wherein the anticodon loop domain binds to a stop codon having a DNA sequence of ‘TAG’ or an RNA sequence of ‘UAG.’

### Claim 10 (depends on 1, 2, 3, 4, 5, 6, 7, 8)

The ttRNA of any one of claims 1 to 8, wherein the anticodon loop domain binds to a stop codon having a DNA sequence of ‘TAA’ or an RNA sequence of ‘UAA.’

### Claim 11 (depends on 1, 2, 3, 4, 5, 6, 7, 8)

The ttRNA of any one of claims 1 to 8, wherein the anticodon loop domain binds to a stop codon having a DNA sequence of ‘TGA’ or an RNA sequence of ‘UGA.’

### Claim 12

The ttRNA of any one of the preceding claims, the variable loop domain comprises a sequence that is selectively bound by an RNA binding protein.

### Claim 13 (depends on 12)

The ttRNA of claim 12, wherein the variable loop domain comprises a sequence for TBP, BoxBv1, BoxBv2, MS2v2, U1Av3, Gas5v4, TARv1, SLBPv1, or SLBPv2.

### Claim 14

The ttRNA of any one of the preceding claims, where the variable loop domain comprises a sequence for BoxBv1.

### Claim 15 (depends on 12)

The ttRNA of claim 12, the variable loop domain comprising a sequence with at least 70% sequence identity to a sequence selected from the group consisting of GGCCCTGAAAAAGGGCC, GGGACATGAGGATCACCCATGTCCC, AGCTTATCCATTGCACTCCGGATAAGCT, GGCCCAGTGGTCTTTGTAGACTGCCTGATGGCC, GGCCAGATCTGAGCCTGGGAGCTCTCTGGCC, CCAAAGGCTCTTCTCAGAGCCACCCA, and GGCTCTTCTCAGAGCC.

### Claim 16

The ttRNA of any one of the preceding claims, where the polynucleotide comprises a sequence with at least 70% sequence identity to a sequence selected from (1) to (8):
(1) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
GGCCCTGAAAAAGGGCCGCGCAGGTTCGAATCCTGCCGACTACG;
(2) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
CGGCCCTGAAAAAGGGCCGCGCAGGTTCGAATCCTGCCGACTACG;
(3) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
GGGGACATGAGGATCACCCATGTCCCGCGCAGGTTCGAATCCTGCCGA
CTACG;
(4) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
AGCTTATCCATTGCACTCCGGATAAGCTGCGCAGGTTCGAATCCTGCC
GACTACG;
(5) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
GGCCCAGTGGTCTTTGTAGACTGCCTGATGGCCGCGCAGGTTCGAATC
CTGCCGACTACG;
(6) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
GGCCAGATCTGAGCCTGGGAGCTCTCTGGCCGCGCAGGTTCGAATCCT
GCCGACTACG;
(7) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
CCAAAGGCTCTTCTCAGAGCCACCCAGCGCAGGTTCGAATCCTGCCGA
CTACG;
and
(8) GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATT
GGCTCTTCTCAGAGCCGCGCAGGTTCGAATCCTGCCGACTACG.

### Claim 17

The ttRNA of any one of the preceding claims, wherein the polynucleotide comprises the sequence of:
GTAGTCGTGGCCGAGTGGTTAAGGCGATGGACTCTAAATCCATTGGCC
CTGAAAAAGGGCCGCGCAGGTTCGAATCCTGCCGACTACG.

### Claim 18

A vector that encodes the ttRNA of any one of the preceding claims.

### Claim 19 (depends on 18)

The vector of claim 18, wherein the vector is a viral vector.

### Claim 20 (depends on 19)

The vector of claim 19, wherein the viral vector is a retroviral vector or an adeno-associated viral vector.

### Claim 21 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20)

A composition for suppressing nonsense mutations in messenger RNA comprising:
the ttRNA of any one of claims 1 to 17, or the vector of any one of claims 18 to 20; and
a guide RNA (gRNA) that specifically binds to a nucleotide sequence about 20 to 100 bps from a nonsense mutation, wherein the gRNA further comprises one or more RNA binding protein sequences that have strong binding affinity for one or more RNA binding protein(s); and
one or more complexes comprising two RNA binding proteins that are fused together, wherein a first RNA binding protein of a complex has strong binding affinity for one or more RNA binding protein sequences of the gRNA, and wherein a second RNA binding protein of a complex has strong binding affinity for a sequence in the variable loop domain of the ttRNA.

### Claim 22 (depends on 21)

The composition of claim 21, wherein the one or more complexes comprise two RNA binding proteins selected from the group consisting of LN, MCP, U1A, GRD-BD, TBP6.7, SLBP and variants thereof.

### Claim 23 (depends on 21, 22)

The composition of claim 21 or claim 22, wherein the one or more complexes comprise TBP and SLBPx3 fused together.

### Claim 24 (depends on 21, 23)

The composition of any one of claim 21 to claim 23, wherein the one or more complexes comprise MCP and LNx4 fused together.

### Claim 25 (depends on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24)

A method for restoring translation in a cell of a nucleotide sequence that has a nonsense mutation comprising:
contacting the cell with a ttRNA of any one of claims 1 to 16, a vector of any one of claims 18 to 20, or a composition of any one of claims 21 to 24.

### Claim 26 (depends on 25)

The method of claim 25, wherein the cell is contacted in vivo, in vitro, or ex vivo.

### Claim 27 (depends on 25, 26)

The method of claim 25 or claim 26, wherein the cell is from a subject that has a disorder associated with a nonsense mutation.

### Claim 28 (depends on 27)

The method of claim 27, where the subject has a disorder selected from the group consisting of Duchenne muscular dystrophy, cystic fibrosis, Beta thalassaemia (β-globin), Hurler syndrome, Dravet Syndrome, and any combination thereof.

### Claim 29 (depends on 28)

The method of claim 28, wherein the subject has Duchenne muscular dystrophy or cystic fibrosis.

### Claim 30

An engineered targeting transfer RNA (ttRNA) comprising a modified variable loop, wherein the modified variable loop comprises a hairpin loop that binds to an RNA binding protein to a greater extent than a tRNA comprising an unmodified variable loop

### Claim 31 (depends on 30)

The engineered ttRNA of claim 30, wherein the tRNA comprising the unmodified variable loop is naturally present in a human cell.

### Claim 32 (depends on 30)

The engineered ttRNA of claim 30, wherein the hairpin loop comprises at least a portion of an aptamer.

### Claim 33 (depends on 30)

The engineered ttRNA of claim 30, wherein the hairpin loop comprises at least a portion of an MS2 domain.

### Claim 34 (depends on 30)

The engineered ttRNA of claim 30, wherein the hairpin loop comprises at least a portion of a BoxB domain.

### Claim 35 (depends on 30)

The engineered ttRNA of claim 30, wherein the hairpin loop comprises at least a portion of a U1hpII domain.

### Claim 36 (depends on 30)

The engineered ttRNA of claim 30, wherein the hairpin loop comprises at least a portion of a Gas5 domain.

### Claim 37 (depends on 30, 31)

The engineered ttRNA of claim 30 or 31, wherein the RNA binding protein is selected from the group consisting of at least a portion of: Lambda N, MCP, U1A, GR-DBD, and any combination thereof.

### Claim 38 (depends on 30, 31, 32)

The engineered ttRNA of any one of claims 30-32, wherein the engineered ttRNA is acylated with an amino acid.

### Claim 39 (depends on 38)

The engineered ttRNA of claim 38, wherein the amino acid is a canonical amino acid or a non-canonical amino acid.

### Claim 40 (depends on 39)

The engineered ttRNA of claim 39, wherein the amino acid is alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine.

### Claim 41 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40)

The engineered ttRNA of any one of claims 30-40, wherein the engineered ttRNA comprises an anticodon loop that recognizes a stop codon implicated in a disease or condition.

### Claim 42 (depends on 41)

The engineered ttRNA of claim 41, wherein the stop codon is a premature stop codon.

### Claim 43 (depends on 41)

The engineered ttRNA of claim 41, wherein the stop codon is UAA.

### Claim 44 (depends on 41)

The engineered ttRNA of claim 41, wherein the stop codon is UGA.

### Claim 45 (depends on 41)

The engineered ttRNA of claim 41, wherein the stop codon is UAG.

### Claim 46 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43)

The engineered ttRNA of any one of claims 30-43, wherein the engineered ttRNA when contacted with the target RNA at least partially disrupts association of a release factor protein with the target RNA.

### Claim 47 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46)

The engineered ttRNA of any one of claims 30-46, wherein the engineered ttRNA comprises an anticodon loop that recognizes a sense codon, wherein the sense codon comprises the mutation in the target RNA that is implicated in the disease or condition.

### Claim 48 (depends on 47)

The engineered ttRNA of claim 47, wherein the sense codon is GCU, GCC, GCA, GCG, CGU, CGC, CGA, CGG, AGA, AGG, AAU, AAC, GAU, GAC, UGU, UGC, GAA, GAG, CAA, CAG, GGU, GGC, GGA, GGG, CAU, CAC, AUU, AUC, AUA, UUA, UUG, CUU, CUC, CUA, CUG, AAA, AAG, AUG, UUU, UUC, CCU, CCC, CCA, CCG, UCU, UCC, UCA, UCG, AGU, AGC, ACU, ACC, ACA, ACG, UGG, UAU, UAC, GUU, GUC, GUA, or GUG.

### Claim 49 (depends on 43, 44, 45)

The engineered ttRNA of any one of claims 43-45, wherein the engineered ttRNA when contacted with the target RNA at least partially disrupts association of a tRNA naturally present in a human with the target RNA, wherein the tRNA naturally present in the human cell comprises an anticodon loop that is complementary to the sense codon.

### Claim 50 (depends on 40, 41, 42, 43, 44, 45)

The engineered ttRNA of any one of claims 40-45, wherein at least one nucleotide of the engineered ttRNA is a chemically modified nucleotide.

### Claim 51 (depends on 40, 41, 42, 43, 44, 45)

The engineered ttRNA of any one of claims 40-45, wherein the engineered ttRNA comprises a sugar modification.

### Claim 52 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49)

The engineered ttRNA of any one of claims 30-49, wherein a nucleotide of the engineered ttRNA comprises a methyl group, a fluoro group, a methoxyethyl group, an ethyl group, a phosphate group, an amide group, an ester group, or any combination thereof.

### Claim 53 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50)

The engineered ttRNA of any one of claims 30-50, wherein the engineered ttRNA is genetically encodable.

### Claim 54 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51)

The engineered ttRNA of any one of claims 30-51, wherein the engineered ttRNA comprises a reducing 3′ hydroxyl group.

### Claim 55 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54)

The engineered ttRNA of any one of claims 30-54, wherein the modified variable loop comprises a hairpin loop that binds to an RNA binding protein to a greater extent than a tRNA comprising an unmodified variable loop is determined by an in vitro assay.

### Claim 56 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55)

The engineered ttRNA of any one of claims 30-55, wherein the disease or condition comprises Rett Syndrome, Duchenne Muscular Dystrophy, Stargardt's Syndrome, or any combination thereof.

### Claim 57 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56)

A system comprising:
(a) the engineered ttRNA of any one of claims 30-56,
(b) a first RNA binding protein, and
(c) a guide RNA comprising an antisense domain, wherein the antisense domain is complementary to at least a portion of a target RNA comprising a mutation, and wherein the mutation of the target RNA is implicated in a disease or condition.

### Claim 58 (depends on 57)

The system of claim 57, wherein the engineered ttRNA further comprises a hairpin loop that binds to a second RNA binding protein.

### Claim 59 (depends on 58)

The system of claim 58, wherein the first RNA binding protein, the second RNA binding protein, or both is independently selected from the group consisting of at least a portion of: Lambda N, MCP, U1A, GR-DBD, and any combination thereof.

### Claim 60 (depends on 57, 58, 59)

The system of any one of claims 57-59, wherein the guide RNA comprises a hairpin capable of binding the first RNA binding protein.

### Claim 61 (depends on 58)

The system of any of one of claim 58, wherein the hairpin comprises a BoxB hairpin.

### Claim 62 (depends on 55, 56, 57, 58, 59, 60, 61)

The system of any one of claims 55-61, wherein the engineered ttRNA is capable of binding the first RNA binding protein.

### Claim 63 (depends on 60)

The system of any one of claim 60, wherein the hairpin comprises a MS2 hairpin.

### Claim 64 (depends on 57, 58, 59, 60, 61, 62)

The system of any one of claims 57-62, wherein the first RNA binding protein comprises a first binding domain that binds a second binding domain of the second RNA binding protein.

### Claim 65 (depends on 64)

The system of claim 64, wherein the first RNA binding protein binds the second RNA binding protein with a KD of from about 1 nM to about 100 μM.

### Claim 66 (depends on 57, 58, 59, 60, 61, 62, 63, 64, 65)

The system of any one of claim 57-65, wherein the guide RNA forms a secondary structure comprising: a stem loop, a cruciform, a toe hold, a mismatch, or any combination thereof.

### Claim 67 (depends on 57, 58, 59, 60, 61, 62, 63, 64, 65, 66)

The system of any one of claims 57-66, wherein the RNA binding protein is delivered exogenously.

### Claim 68 (depends on 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67)

The system of any one of claims 57-67, wherein the RNA binding protein is endogenously expressed.

### Claim 69 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68)

A vector comprising a polynucleotide sequence encoding for the engineered ttRNA of any one of claims 30-56 or the engineered ttRNA and guide RNA of the system of any one of claims 57-68.

### Claim 70 (depends on 69)

The vector of claim 69, wherein the vector comprises a liposome, a viral vector, a nanoparticle, or any combination thereof.

### Claim 71 (depends on 69)

The vector of claim 69, wherein the vector is the viral vector, and wherein the viral vector is an AAV vector.

### Claim 72 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71)

An isolated cell that comprises the engineered ttRNA of any one of claims 30-56, the system of any one of claims 57-68, or the vector of any one of claims 69-71.

### Claim 73 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71)

A pharmaceutical composition in unit dose form comprising:
(a) the engineered ttRNA of any one of claims 30-56, the engineered ttRNA and guide RNA of the system of any one of claims 57-68, or the vector of any one of claims 69-71, and
(b) a pharmaceutically acceptable: excipient, diluent, or carrier.

### Claim 74 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71)

A method of at least partially ameliorating or preventing a disease or condition in a subject in need thereof comprising: administering to the subject the engineered ttRNA of any one of claims 30-56, the engineered ttRNA and guide RNA of the system of any one of claims 57-68, the vector of any one of claims 69-71, or the pharmaceutical composition of claim 70, and wherein the administering is sufficient at least partially ameliorate the disease or condition in the subject.

### Claim 75 (depends on 74)

The method of claim 74, wherein the administering is by intravenous injection, intramuscular injection, an intrathecal injection, an intraorbital injection, a subcutaneous injection, or any combination thereof.

### Claim 76 (depends on 74, 75)

The method of claim 74 or 75, wherein the disease or condition is selected from the group consisting of: a neurodegenerative disorder, a muscular disorder, a metabolic disorder, an ocular disorder, a cancer, and any combination thereof.

### Claim 77 (depends on 74, 75, 76)

The method of any one of claims 74-76, wherein the disease or condition comprises Rett Syndrome.

### Claim 78 (depends on 74, 75, 76)

The method of any one of claims 74-76, wherein the subject is a mammal.

### Claim 79 (depends on 78)

The method of claim 78, wherein the mammal is a human.

### Claim 80 (depends on 79)

The method of claim 79, wherein the mammal is a non-human mammal.

### Claim 81 (depends on 74, 75, 76, 77, 78, 79, 80)

The method of any one of claims 74-80, wherein the subject has been diagnosed with the disease or condition by an in vitro diagnostic.

### Claim 82 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 64, 65, 66, 67, 68, 69, 70, 71)

A kit comprising: the engineered ttRNA of any one of claims 30-56 in a container, the engineered ttRNA and guide RNA of the system of any one of claims 64-68 in a container, or the vector of any one of claims 69-71 in a container.

### Claim 83 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71)

A method of making a kit, comprising placing at least in part, into a container:
the engineered ttRNA of any one of claims 30-56, the engineered ttRNA and guide RNA of the system of any one of claims 57-68, or the vector of any one of claims 69-71.

### Claim 84 (depends on 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71)

A method of making a pharmaceutical composition, comprising contacting a pharmaceutically acceptable: excipient, carrier, or diluent with at least one of the engineered ttRNA of any one of claims 30-56, the engineered ttRNA and guide RNA of the system of any one of claims 57-68, or the vector of any one of claims 69-71.