RNA-Guided Human Genome Engineering
AssigneePresident and Fellows of Harvard College
InventorsGeorge M. Church, Prashant G. Mali, Luhan Yang
Life of this patent
Estimating the term…
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims31
1-14. (canceled)
An RNA-guided system for use in a eukaryotic cell comprising
- (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
- (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system,
- wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides,
- wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system.
An RNA-guided system for use in a eukaryotic cell comprising
- (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
- wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
An RNA-guided system for use in a eukaryotic cell comprising
- (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
- wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).
Dependencies are inferred from the claim text.