Primers for multiplex pcr
AssigneesYissum Research Development Company of the Hebrew University of Jerusalem, Hadasit Medical Research Services and Development Ltd.
InventorsYuval DOR, Ruth SHEMER, Daniel NEIMAN, Benjamin GLASER
Life of this patent
Estimating the term…
Abstract
Primer sets comprising a 3′ region of homology to a 5′ segment of a target nucleic acid molecule and a 5′ first adapter sequence wherein the first adapter sequence comprises a 5′ first and 3′ second region and wherein said first region is between 50% and 99% of the first adapter sequence; and a second primer comprising a 3′ region identical to the first region of the first adapter sequence and a 5′ second adapter sequence are provided. Methods of performing polymerase chain reaction (PCR), producing a sequencing library and determining the cell type of origin of cell free DNA (cfDNA) are also provided.
Claims28
A primer set comprising:
- a. a first primer comprising a 3′ region of homology to a 5′ segment of a target nucleic acid molecule and a 5′ first adapter sequence wherein said first adapter sequence comprises a 5′ first and 3′ second region and wherein said first region is between 50% and 99% of the first adapter sequence;
- and
- b. a second primer comprising a 3′ region identical to said first region of said first adapter sequence and a 5′ second adapter sequence.
(canceled)
(canceled)
The primer set of claim 14, wherein said first adapter sequence comprises the sequence TCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:
- 1), said second region of said first adapter and/or said second region of said third adapter comprises the sequence TTCCGATC (SEQ ID NO:
- 3), or both.
(canceled)
(canceled)
A method of determining the cell type of origin of cfDNA, the method comprising:
- a. providing a sample comprising at least two target nucleic acid molecules, wherein said at least two target nucleic acid molecules are cfDNA, that comprise at least one cell type-specific methylation/unmethylated site and wherein said at least two target nucleic acid molecules of cfDNA have undergone bisulfite conversion;
- b. performing a first PCR reaction with said at least two target nucleic acid molecules and at least two first primers to produce first adapter labeled target nucleic acid hybrid molecules, wherein each of said first primers comprises
- i. a 3′ region of homology to a 5′ segment of one of said at least two target nucleic acid molecules;
- and
- ii. a 5′ first adapter sequence common to all first primers wherein said first adapter sequence comprises a 5′ first and 3′ second region;
- c. performing a second PCR reaction with said first primer labeled hybrid molecules and at least two second primers to produce first and second adapter labeled target nucleic acid hybrid molecules, wherein each of said second primers comprises
- i. a 3′ region identical to said first region of said first adapter sequence;
- and
- ii. a 5′ second adapter sequence;
- d. sequencing said first and second adapter labeled target nucleic acid molecules;
- and
- e. determining a methylation status of said methylation/unmethylated site according to the base sequenced at said methylation/unmethylated site;
- wherein the presence of a methylation mark or lack of a methylation mark that is cell type-specific indicates that said cfDNA originates from said cell type, thereby determining the cell type of origin of said cfDNA.
(canceled)
(canceled)
(canceled)
(canceled)
A method of detecting beta cell cfDNA in a sample, the method comprising:
- a. receiving a sample comprising cfDNA;
- b. detecting in said sample a DNA sequence of a region of an insulin (INS) gene, wherein said region is between nucleotides 1058-1222 downstream of an INS transcriptional start site and comprises at least one cytosine base selected from cytosine 1080, 1102, 1116, 1124, 1170, 1173, 1181, 1195, 1197 and 1202;
- and
- c. determining a methylation status of said at least one cytosine base, wherein absence of methylation on said at least one cytosine base indicates the presence of beta cell cfDNA;
- thereby detecting beta cell cfDNA in a sample.
Dependencies are inferred from the claim text.