Intron fragments
AssigneeNeuracle Genetics Inc.
InventorsHoon Young KONG, Jong-Mook KIM, Jee Yong KIM, Sunhwa SHIN, Kyungwon LEE, Joo Seok HAN
Life of this patent
Estimating the term…
Abstract
Novel intron fragments are provided. The intron fragments can increase gene expression to levels equal to or higher than those achieved by the full-length intron while maintaining their ability to increase gene expression even when combined with various types of promoters and splicing donors. Particularly, the intron fragments enable loading of larger transgenes when used in genetic information delivery systems whose size is limited, for example, adeno-associated viruses (AAVs) and rhabdoviruses. Therefore, the use of the intron fragments is expected to extend the range of therapeutic genes.
Claims34
An isolated polynucleotide comprising an untranslated nucleic acid sequence having at least about 70% sequence identity to nucleotides 501 to 924 of SEQ ID NO:
- 1 (SEQ ID NO:
- 74), wherein the untranslated nucleic acid sequence does not comprise the nucleotide sequence set forth in SEQ ID NO:
- 1.
2-3. (canceled)
5-6. (canceled)
8-9. (canceled)
11-12. (canceled)
15-18. (canceled)
(canceled)
22-56. (canceled)
A polynucleotide comprising (i) a transgene and (ii) a control element operably linked to the transgene, wherein the control element comprises (from 5′ to 3′):
- 1) the CMV enhancer set forth in SEQ ID NO:
- 4;
- 2) a promoter selected from the CMV promoter sequence set forth in SEQ ID NO:
- 5 or 6, the EF-1α promoter sequence set forth in SEQ ID NO:
- 7, or the chicken β-actin promoter sequence set forth in SEQ ID NO:
- 8;
- 3) an exon 1 (E1) sequence selected from the CMV E1 sequence set forth in SEQ ID NO:
- 12, the EF-1α E1 sequence set forth in SEQ ID NO:
- 13, or the chicken β-actin E1 sequence set forth in SEQ ID NO:
- 14 or 15;
- 4) the splicing donor sequence set forth in SEQ ID NO:
- 9 or 10;
- 5) an untranslated nucleic acid sequence comprising, consisting essentially of, or consisting of the nucleotide sequence set forth in SEQ ID NO:
- 2 (TGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTC AGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAG), SEQ ID NO:
- 3 (CCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTT TCTTCCATTTCAG), or SEQ ID NO:
- 57 (TTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAG);
- and
- 6) the EF-1α E2 sequence set forth in SEQ ID NO:
- 11.
60-64. (canceled)
(canceled)
71-75. (canceled)
(canceled)
A method of treating an ophthalmic disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus particle and a pharmaceutically acceptable carrier, wherein the recombinant adeno-associated virus particle comprises (a) an AAV type 8 capsid protein and (b) a polynucleotide comprising (i) a transgene, which comprises the nucleotide sequence set forth in SEQ ID NO:
- 23, and (ii) a control element operably linked to the transgene, wherein the control element comprises (from 5′ to 3′):
- 1) the cytomegalovirus (CMV) enhancer sequence set forth in SEQ ID NO:
- 4,
- 2) the chicken β-actin promoter sequence set forth in SEQ ID NO:
- 8,
- 3) the chicken β-actin exon 1 (E1) sequence set forth in SEQ ID NO:
- 15,
- 4) the splicing donor sequence of the chicken β-actin intron set forth in SEQ ID NO:
- 10,
- 5) an untranslated nucleic acid sequence comprising, consisting essentially of, or consisting of the nucleotide sequence set forth in SEQ ID NO:
- 2 (TGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTC AGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAG), SEQ ID NO:
- 3 (CCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTT TCTTCCATTTCAG), or SEQ ID NO:
- 57 (TTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAG), and
- 6) the EF-1α exon 2 (E2) sequence set forth in SEQ ID NO:
- 11.
79-80. (canceled)
82-85. (canceled)
87-90. (canceled)
Dependencies are inferred from the claim text.