# US 2021/0340538 A1 · Compositions and methods for prevention of bladder fibrosis

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2021/0340538 A1
- Document ID: US20210340538A1
- Status: Published application
- Kind: A1
- Application number: 17/306,929
- Filed: 2021-05-03
- Published: 2021-11-04
- Earliest claimed: 2020-05-03
- Assignees: Washington University; Wisconsin Alumni Research Foundation
- Inventors: Jianghui Hou; Dale Bjorling; Zun-Yi Wang
- Web page: https://patentgrep.com/patent/US20210340538A1

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 31/70: Carbohydrates; Sugars; Derivatives thereof (sorbitol A61K31/047)
- A61K 47/549: {Sugars, nucleosides, nucleotides or nucleic acids}
- A61K 47/554: {the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid}
- A61K 47/59: obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- C12N 2310/141: MicroRNAs, miRNAs
- C12N 2310/321: 2'-O-R Modification
- C12N 2310/3515: Lipophilic moiety, e.g. cholesterol
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

## Claims

### Claim 1

A composition for the treatment of bladder fibrosis in a patient in need, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence:
(SEQ ID NO 5)
AACCGAUUUCuuuUGGUGCUAUU.

### Claim 2 (depends on 1)

The composition of claim 1, wherein the passenger RNA strand further comprising a 2′-O-methylation modification to increase stability and a cholesterol conjugated to a 3′-end of the passenger RNA strand to enhance cellular uptake.

### Claim 3 (depends on 2)

The composition of claim 2, further comprising a carrier molecule.

### Claim 4 (depends on 3)

The composition of claim 3, wherein the carrier molecule comprises branched polyethylenimine.

### Claim 5 (depends on 4)

The composition of claim 4, further comprising an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands.

### Claim 6 (depends on 5)

The composition of claim 5, wherein the polyethylenimine, the working RNA strand, and the passenger RNA strand form a polyplex.

### Claim 7 (depends on 6)

The composition of claim 6, wherein the polyplex is dissolved in a glucose solution.

### Claim 8 (depends on 7)

The composition of claim 7, wherein the glucose solution is a 0.5% glucose solution.

### Claim 9

A method of preventing, reducing, or reversing bladder fibrosis in a patient in need, the method comprising administering an effective amount of a composition, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence:
(SEQ ID NO 5)
AACCGAUUUCuuuUGGUGCUAUU.

### Claim 10 (depends on 9)

The method of claim 9, wherein the passenger RNA strand further comprises a 2′-O-methylation modification to increase stability and a cholesterol conjugated to a 3′-end of the passenger RNA strand to enhance cellular uptake.

### Claim 11 (depends on 10)

The method of claim 10, wherein the composition further comprises a carrier molecule.

### Claim 12 (depends on 11)

The method of claim 11, wherein the carrier molecule comprises branched polyethylenimine.

### Claim 13 (depends on 12)

The method of claim 12, the composition further comprises an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands.

### Claim 14 (depends on 13)

The method of claim 13, wherein the polyethylenimine, the working RNA strand, and the passenger RNA strand form a polyplex.

### Claim 15 (depends on 14)

The method of claim 14, wherein the polyplex is dissolved in a glucose solution.

### Claim 16 (depends on 15)

The method of claim 15, wherein the glucose solution is a 0.5% glucose solution.