# US 2021/0340535 A1 · DUAL-ACTING siRNA BASED MODULATION OF C9orf72

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2021/0340535 A1
- Document ID: US20210340535A1
- Status: Published application
- Kind: A1
- Application number: 17/213,887
- Filed: 2021-03-26
- Published: 2021-11-04
- Earliest claimed: 2020-03-27
- Assignees: University of Massachusetts
- Applicants: University of Massachusetts
- Inventors: Anastasia Khvorova; Bruno Miguel da Cruz Godinho; James W. Gilbert
- Web page: https://patentgrep.com/patent/US20210340535A1

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 31/7088: Compounds having three or more nucleosides or nucleotides
- A61K 31/713: Double-stranded nucleic acids or oligonucleotides
- C12N 2310/11: Antisense
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/314: Phosphoramidates
- C12N 2310/315: Phosphorothioates
- C12N 2310/321: 2'-O-R Modification
- C12N 2310/322: 2'-R Modification
- C12N 2310/3233: Morpholino-type ring
- C12N 2310/332: Abasic residue
- C12N 2310/343: having patterns, e.g. ==--==--==--
- C12N 2310/351: Conjugate
- C12N 2310/3515: Lipophilic moiety, e.g. cholesterol
- C12N 2310/3519: Fusion with another nucleic acid
- C12N 2320/30: Special therapeutic applications
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

This disclosure relates to novel C9ORF72 targeting sequences. Novel sense and antisense dual-targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided.

## Claims

### Claim 1

A double-acting RNA silencing agent comprising a first oligonucleotide strand and a second oligonucleotide strand, each strand comprising a 5′ end and a 3′ end, wherein the first strand inhibits expression of a C9ORF72 sense transcript and the second strand inhibits expression of a C9ORF72 antisense transcript, wherein the first and second oligonucleotide strand are substantially complementary to a non-repeat region in the C9ORF72 sense and antisense transcript.

### Claim 2 (depends on 1)

The double-acting RNA silencing agent of claim 1, wherein the first strand and the second strand comprise guide strands forming a duplex comprising 15 to 30 nucleotides in length; and optionally wherein the first strand and second strand independently each comprise at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides, and each strand comprises substantially complementary to a target sequence.

### Claim 3

(canceled)

### Claim 4 (depends on 1)

The double-acting RNA silencing agent of claim 1, further comprising a hydrophilic moiety or a hydrophobic moiety; and optionally wherein the hydrophobic moiety comprises alkyl, alkenyl, aryl, vitamin, vitamin derivative, cholesterol, cholesterol derivative, lipophilic amino acid, or combinations thereof.

### Claim 5

(canceled)

### Claim 6 (depends on 1)

The double-acting RNA silencing agent of claim 1, wherein the first strand comprises a region of complementarity, which is substantially complementary to
5′ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG 3′,
5′AGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGAA 3′,
or
5′AAGAUUAACCAGAAGAAAAC 3′.

### Claim 7

(canceled)

### Claim 8 (depends on 1)

The double-acting RNA silencing agent of claim 1, wherein the second strand comprises a region of complementarity, which is substantially complementary to
5′UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU 3′
or
5′GUUUUCUUCUGGUUAAUCUA 3′.

### Claim at position 9

9-10. (canceled)

### Claim 11 (depends on 1)

The double-acting RNA silencing agent of claim 1, wherein each strand comprises at least one or more chemically-modified nucleotides;
optionally wherein the modified nucleotide comprises a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a non-natural-base-comprising nucleotide;
optionally wherein the first oligonucleotide strand is substantially complementary to the second oligonucleotide strand;
optionally wherein at least one nucleotide is mismatched between the first strand 5′ end and second strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and second strand 5′ end; and
optionally comprising at least one single stranded nucleotide overhang.

### Claim at position 11

12-15. (canceled)

### Claim 16 (depends on 1)

The double-acting RNA silencing agent claim 1, wherein:
the first strand 5′ end and second strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or
the first strand 3′ end and second strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

### Claim 17

(canceled)

### Claim 18 (depends on 1)

A pharmaceutical composition comprising the double-acting RNA silencing agent of claim 1 and a pharmaceutically acceptable carrier.

### Claim 19 (depends on 1)

A method for treating or managing a disease or disorder, the method comprising administering to a subject having a disease- or disorder-associated nucleotide repeat sequence within the C9orf72 gene, a therapeutically effective amount of the double-acting RNA silencing agent of claim 1.

### Claim 20 (depends on 19)

The method of claim 19, wherein the disease or disorder comprises amyotrophic lateral sclerosis or frontotemporal dementia.

### Claim 21

(canceled)

### Claim 22

A branched oligonucleotide compound comprising at least two double-acting RNA silencing agents, wherein each double-acting RNA silencing agent comprises:
a first guide strand comprising a 5′ end and a 3′ end, and
a second guide strand comprising a 5′ end and a 3′ end, wherein the at least two double-acting RNA silencing agents are connected to one another by one or more moieties comprising a linker, a spacer, or a branching point.

### Claim 23 (depends on 22)

The branched oligonucleotide compound of claim 22, wherein each double-acting RNA silencing agent comprises a linker, a spacer, or a branching point, at the 3′ end or at the 5′ end of the first or second guide strand;
optionally wherein each second guide strand comprises the linker, spacer, or branching point at the 3′ end; and
optionally wherein each linker comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, and wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, bears a hydroxyl substituent, or bears an oxo substituent.

### Claim at position 20

24-25. (canceled)

### Claim 26 (depends on 22)

The branched oligonucleotide compound of claim 22, further comprising a hydrophobic moiety or a hydrophilic moiety; and optionally wherein the hydrophobic moiety comprises alkyl, alkenyl, aryl, vitamin, vitamin derivative, cholesterol, cholesterol derivative, lipophilic amino acid, or a combination thereof.

### Claim 27

(canceled)

### Claim 28 (depends on 22)

The branched oligonucleotide compound of claim 22, the first guide strand comprising a region of complementarity, which is substantially complementary to
5′ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG 3′,
5′AGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGAA 3′,
or
5′AAGAUUAACCAGAAGAAAAC 3′.

### Claim 29 (depends on 22)

The branched oligonucleotide compound of claim 22, the second guide strand comprising a region of complementarity, which is substantially complementary to
5′UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU 3′
or
5′GUUUUCUUCUGGUUAAUCUA 3′.

### Claim at position 25

30-32. (canceled)

### Claim 33 (depends on 22)

The branched oligonucleotide compound of claim 22, wherein each strand comprises one or more chemically-modified nucleotides; and optionally wherein the modified nucleotide comprises a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.

### Claim 34

(canceled)

### Claim 35 (depends on 22)

The branched oligonucleotide compound of claim 22, wherein the first guide strand is substantially complementary to the second guide strand; and
optionally wherein at least one nucleotide is mismatched between the first guide strand 5′ end and second guide strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and second strand 5′ end; or
optionally wherein at least one dual-acting RNA silencing agent comprises at least one single stranded nucleotide overhang.

### Claim at position 29

36-37. (canceled)

### Claim 38 (depends on 22)

The branched oligonucleotide compound of claim 22, wherein:
the first guide strand 5′ end and second guide strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or
the first guide strand 3′ end and second guide strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

### Claim 39

(canceled)

### Claim 40 (depends on 22)

A pharmaceutical composition comprising the branched oligonucleotide compound of claim 22 and a pharmaceutically acceptable carrier.

### Claim 41 (depends on 22)

A method for treating or managing a disease or disorder comprising administering to a subject having a disease- or disorder-associated nucleotide repeat sequence within the C9orf72 gene a therapeutically effective amount of the branched oligonucleotide compound of claim 22.

### Claim 42 (depends on 41)

The method of claim 41, where in the disease or disorder comprises amyotrophic lateral sclerosis or frontotemporal dementia.

### Claim 43

(canceled)

### Claim 44

A double-acting, double stranded (ds) RNA comprising a first guide strand and a second guide strand, wherein at least one nucleotide is mismatched between the first strand 5′ end and second strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and second strand 5′ end, wherein the first guide strand inhibits expression of a sense mRNA target and the second guide strand inhibits expression of an antisense mRNA target.

### Claim 45 (depends on 44)

The double-acting dsRNA of claim 44, wherein the first guide strand 5′ end and second guide strand 3′ end comprises three nucleotide mismatches and the first guide strand 3′ end and second guide strand 5′ end comprises three nucleotide mismatches; and optionally wherein the dsRNA comprises at least one single stranded nucleotide overhang.

### Claim 46

(canceled)

### Claim 47 (depends on 44)

The double-acting dsRNA of claim 44, wherein the dsRNA comprises at least one modified nucleotide; and optionally wherein the modified nucleotide comprises a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.

### Claim 48

(canceled)

### Claim 49 (depends on 44)

The double-acting dsRNA of claim 44, wherein the first guide strand comprising a region of complementarity, which is substantially complementary
5′ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG 3′
or
5′AAGAUUAACCAGAAGAAAAC 3′.

### Claim 50 (depends on 44)

The double-acting dsRNA of claim 44, wherein the second guide strand comprising a region of complementarity, which is substantially complementary
5′UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU 3′
or
5′GUUUUCUUCUGGUUAAUCUA 3′.

### Claim at position 43

51-52. (canceled)

### Claim 53 (depends on 44)

The double-acting dsRNA of claim 44, wherein the first guide strand is substantially complementary to the second guide strand; and optionally wherein at least one nucleotide is mismatched between the first guide strand 5′ end and second guide strand 3′ end, and at least one nucleotide is mismatched between the first guide strand 3′ end and second guide strand 5′ end.

### Claim 54

(canceled)

### Claim 55 (depends on 44)

The double-acting dsRNA of claim 44, wherein:
the first strand 5′ end and second strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or
the first strand 3′ end and second strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

### Claim 56

(canceled)

### Claim 57 (depends on 44)

The double-acting dsRNA of claim 44, wherein at least one of the first target and second target comprises a disease-associated nucleotide sequence.

### Claim 58 (depends on 44)

A pharmaceutical composition comprising the double-acting dsRNA of claim 44 and a pharmaceutically acceptable carrier.

### Claim 59 (depends on 44)

A method for treating or managing a disease or disorder comprising administering to a subject having a disease- or disorder-associated nucleotide repeat sequence a therapeutically effective amount of the double-acting dsRNA of claim 44.

### Claim 60 (depends on 59)

The method of claim 59, wherein the repeat sequence is within the C9orf72 gene; and optionally wherein the disease or disorder comprises amyotrophic lateral sclerosis or frontotemporal dementia.

### Claim at position 52

61-62. (canceled)