# US 2021/0340533 A1 · Oligonucleotides for tissue specific gene expression modulation

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2021/0340533 A1
- Document ID: US20210340533A1
- Status: Published application
- Kind: A1
- Application number: 17/132,803
- Filed: 2020-12-23
- Published: 2021-11-04
- Earliest claimed: 2019-12-23
- Assignees: University of Massachusetts
- Applicants: University of Massachusetts
- Inventors: Anastasia Khvorova; Chantal Ferguson
- Web page: https://patentgrep.com/patent/US20210340533A1

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 47/542: {Carboxylic acids, e.g. a fatty acid or an amino acid}
- A61K 47/549: {Sugars, nucleosides, nucleotides or nucleic acids}
- A61K 47/554: {the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid}
- A61P 25/28: for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
- C12N 2310/113: targeting other non-coding nucleic acids, e.g. antagomirs
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/315: Phosphorothioates
- C12N 2310/322: 2'-R Modification
- C12N 2310/344: Position-specific modifications, e.g. on every purine, at the 3'-end
- C12N 2310/346: having a combination of backbone and sugar modifications
- C12N 2310/3515: Lipophilic moiety, e.g. cholesterol
- C12N 2320/31: Combination therapy
- C12N 2320/32: Special delivery means, e.g. tissue-specific
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

## Abstract

This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.

## Claims

### Claim 1

A therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising:
a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and
a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to an off-target tissue.

### Claim 2 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the first conjugate and second conjugate are compounded together in a same unitary composition comprising both conjugates.

### Claim 3 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the first conjugate and second conjugate are in separate pharmaceutical compositions.

### Claim 4 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the RNA silencing agent inhibits the expression of Apoliprotein E (ApoE) gene in an organism;
optionally wherein the RNA silencing agent comprises an RNA molecule comprising 15 to 35 bases in length, comprising a region of complementarity which is substantially complementary to 5′ GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3′; and
optionally wherein the RNA silencing agent comprises a region of complementarity which is substantially complementary to one or more of 5′ GAUUCACCAAGUUUA 3′ and 5′ CAAGUUUCACGCAAA 3′, or optionally wherein the RNA molecule comprises single stranded (ss) RNA or double stranded (ds) RNA.

### Claim at position 5

5-7. (canceled)

### Claim 8 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the first conjugate comprises a Di-siRNA; and optionally wherein the antagonist to the RNA silencing agent comprises a single-stranded oligonucleotide complementary to the guide strand of the siRNA of the first conjugate.

### Claim 9

(canceled)

### Claim 10 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the second targeting agent comprises a GalNac.

### Claim 11 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the antagonist to the RNA silencing agent comprises one or more locked nucleic acids.

### Claim 12 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the antagonist to the RNA silencing agent comprises 8 to 20 bases in length; and optionally wherein the antagonist to the RNA silencing agent comprises 8 bases in length or 15 bases in length.

### Claim at position 11

13-14. (canceled)

### Claim 15 (depends on 1)

The therapeutic combination of drugs of claim 1, wherein the off-target tissue comprises a clearance tissue; and optionally wherein the off-target tissue comprises one or more of liver tissue, kidney tissue, and spleen tissue.

### Claim at position 13

16-17. (canceled)

### Claim 18

A method of treating, suppressing, or reducing the severity of a neurodegenerative disease in a subject, the method comprising administering to the subject a therapeutic combination of drugs, the combination comprising:
a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to a central nervous system, and
a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a tissue outside the central nervous system, to block the action of the first conjugate outside the central nervous system.

### Claim 19 (depends on 18)

The method of treating of claim 18, wherein the first conjugate is administered to the subject prior to the second conjugate, concurrently with the second conjugate, or after the second conjugate.

### Claim 20 (depends on 18)

The method of claim 18, wherein the neurodegenerative disease is a disorder caused, in whole or in part, by abnormalities in cholesterol transport.

### Claim 21 (depends on 18)

The method of claim 18, wherein the neurodegenerative disease comprises one or more of amyotrophic lateral disease (ALS) and Alzheimer's disease (AD).

### Claim 22 (depends on 18)

The method of claim 18, wherein the RNA silencing agent inhibits expression of Apoliprotein E (ApoE) gene in the central nervous system and the second conjugate maintains cholesterol homeostasis;
optionally wherein the RNA silencing agent is an RNA molecule comprising 15 to 35 bases in length, comprising a region of complementarity which is substantially complementary to 5′ GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3′; and
optionally wherein the RNA silencing agent comprises a region of complementarity which is substantially complementary to one or more of 5′ GAUUCACCAAGUUUA 3′ and 5′ CAAGUUUCACGCAAA 3′, or optionally wherein said RNA molecule comprises single stranded (ss) RNA or double stranded (ds) RNA.

### Claim at position 19

23-25. (canceled)

### Claim 26 (depends on 18)

The method of claim 18, wherein the first conjugate comprises a Di-siRNA; and optionally wherein the antagonist to the RNA silencing agent comprises a single-stranded oligonucleotide complementary to the guide strand of the siRNA of the first conjugate.

### Claim 27

(canceled)

### Claim 28 (depends on 18)

The method of claim 18, wherein the second targeting agent targets the second conjugate to a off-target tissue; and optionally wherein the second targeting agent comprises a GalNac.

### Claim 29

(canceled)

### Claim 30 (depends on 18)

The method of claim 18, wherein the antagonist to the RNA silencing agent comprises one or more locked nucleic acids.

### Claim 31 (depends on 18)

The method of claim 18, wherein the antagonist to the RNA silencing agent comprises 8 to 20 bases in length; and optionally wherein the antagonist to the RNA silencing agent comprises 8 bases in length or 15 bases in length.

### Claim at position 26

32-33. (canceled)

### Claim 34 (depends on 18)

The method of claim 18, wherein the tissue outside the central nervous system comprises a clearance tissue.

### Claim 35 (depends on 18)

The method of claim 18, wherein the tissue outside the central nervous system comprises one or more of liver tissue, kidney tissue, and spleen tissue.

### Claim 36

A kit for the treatment or management of a neurodegenerative disease, the kit comprising:
a first pharmaceutically acceptable composition of a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to a central nervous system,
a second pharmaceutically acceptable composition of a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a tissue outside the central nervous system, and
instructions for the administration of the first composition and second composition for treatment of a neurodegenerative disease.

### Claim 37

A method of treating, suppressing, or reducing the severity of a neurodegenerative disease in a subject, the method comprising administering to the subject a therapeutically effective amount of an RNA silencing agent inhibiting the expression of a gene in a central nervous system, the improvement comprising administering to the subject a conjugate comprising an antagonist of the RNA silencing agent and a targeting agent that targets the conjugate to a liver, to selectively inhibit the RNA silencing agent in the liver.

### Claim 38

A combination comprising:
a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to a target tissue, and
a second conjugate comprising an anti-RNA silencing agent and a second targeting agent that targets the second conjugate to an off-target tissue.

### Claim 39 (depends on 38)

The combination of claim 38, wherein the first conjugate and second conjugate are compounded together in a same unitary composition comprising both conjugates.

### Claim 40 (depends on 38)

The combination of claim 38, wherein the first conjugate and second conjugate are in separate pharmaceutical compositions.

### Claim 41 (depends on 38)

The combination of claim 38, wherein the RNA silencing agent comprises single stranded (ss) RNA or double stranded (ds) RNA.

### Claim 42 (depends on 38)

The combination of claim 38, wherein the first targeting agent comprises cholesterol, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or docosanoic acid (DCA).

### Claim 43 (depends on 38)

The combination of claim 38, wherein the RNA silencing agent comprises an siRNA comprising a guide strand with a 5′ end and a 3′ end and a passenger strand with a 5′ end and a 3′ end; optionally wherein the first targeting agent is conjugated to the passenger strand 3′ end; and optionally wherein the first targeting comprises cholesterol, EPA, DHA, or DCA.

### Claim at position 37

44-45. (canceled)

### Claim 46 (depends on 38)

The combination of claim 38, wherein the anti-RNA silencing agent comprises a single-stranded oligonucleotide sufficiently complementary to the RNA silencing agent; and optionally wherein the anti-RNA silencing agent comprises a single-stranded oligonucleotide sufficiently complementary to the guide strand of the siRNA.

### Claim 47

(canceled)

### Claim 48 (depends on 38)

The combination of claim 38, wherein the second targeting agent comprises a GalNAc;
optionally wherein the anti-RNA silencing agent comprises one or more locked nucleic acids;
optionally wherein the anti-RNA silencing agent comprises one or more 2′-methoxy nucleotide modifications;
optionally wherein the anti-RNA silencing agent comprises one or more phosphorothioate linkages; and
optionally wherein all internucleotide linkages in the anti-RNA silencing agent comprises phosphorothioate linkages.

### Claim at position 41

49-52. (canceled)

### Claim 53 (depends on 38)

The combination of claim 38, wherein the anti-RNA silencing agent comprises 8 to 20 bases in length; and optionally wherein the anti-RNA silencing agent comprises 8 bases in length, 9 bases in length, or 15 bases in length.

### Claim at position 43

54-56. (canceled)

### Claim 57 (depends on 38)

The combination of any one of claim 38, wherein the off-target tissue comprises a clearance tissue; optionally wherein the off-target tissue comprises one or more of liver tissue, kidney tissue, and spleen tissue, and optionally wherein the target tissue comprises one or more of tissue in the central nervous system, muscle tissue, heart tissue, and lung tissue.

### Claim at position 45

58-59. (canceled)

### Claim 60 (depends on 38)

A method of reducing off-target tissue silencing from an RNA silencing agent in a subject, the method comprising administering to the subject the first conjugate and second conjugate of claim 38; and optionally wherein the first conjugate and second conjugate are administered simultaneously or sequentially.

### Claim at position 47

61-62. (canceled)