Compositions and methods for inhibition of lineage specific antigens
AssigneeThe Trustees of Columbia University in the City of New York
InventorsSiddhartha MUKHERJEE, Florence BOROT, Abdullah Mahmood ALI
Life of this patent
Estimating the term…
Abstract
Disclosed herein are methods of administering an agent targeting a lineage-specific cell-surface antigen, e.g., CD33, and a population of hematopoietic cells that are deficient in the lineage-specific cell-surface antigen, e.g., CD33 for immunotherapy of hematological malignancies. Cells comprising mutations in CD33 are also provided, as are gRNAs targeting CD33.
Claims21
A genetically engineered hematopoietic stem or progenitor cell, which comprises a genetic mutation in exon 3 of an endogenous CD33 gene, wherein the genetic mutation is at a site targeted by a gRNA which comprises the nucleotide sequence of CCUCACUAGACUUGACCCAC (SEQ ID NO:
- 70), and wherein the genetic mutation causes a reduced expression level of CD33 as compared with a wild-type counterpart cell.
Dependencies are inferred from the claim text.