# US 2021/0171985 A1 · Compositions and methods for genomic editing by insertion of donor polynucleotides

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2021/0171985 A1
- Document ID: US20210171985A1
- Status: Published application
- Kind: A1
- Application number: 17/178,737
- Filed: 2021-02-18
- Published: 2021-06-10
- Earliest claimed: 2018-06-28
- Assignees: Crispr Therapeutics AG
- Applicants: Crispr Therapeutics AG
- Inventors: Troy Dean CARLO; Roman Lvovitch BOGORAD
- Web page: https://patentgrep.com/patent/US20210171985A1

## CPC

- C12N 15/111: {General methods applicable to biologically active non-coding nucleic acids}
- C12N 15/907: {in mammalian cells}
- C12N 9/226: {Class 2 CAS enzyme complex, e.g. single CAS protein}
- C12N 15/11: DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity}
- A61K 48/00: Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K 48/0025: {wherein the non-active part clearly interacts with the delivered nucleic acid}
- C12N 2310/18: acting by a non-sequence specific mechanism
- C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR]
- C12N 2320/33: Alteration of splicing
- C12N 2800/80: Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

The present disclosure provides donor polynucleotides, genome editing systems, methods, and kits which correct or induce a mutation in a gDNA.

## Claims

### Claim 1

A donor polynucleotide comprising a non-replicative double-stranded DNA molecule (dsDNA) comprising a nucleotide sequence which corrects a mutation that causes Glycogen Storage Disease 1a in a genomic DNA molecule (gDNA) molecule in a cell, wherein the mutation is a protein-coding mutation proximal to a 3′ splice site in the human G6PC gene, the donor polynucleotide comprising,
(i) a first strand comprising from 5′ to 3′: (a) a nucleotide sequence comprising splicing signals to control processing of a precursor mRNA (pre-mRNA) transcribed from the gDNA, wherein the splicing signals are a branch point, a polypyrimidine tract, and a natural or enhanced 3′ splice site; and (b) a nucleotide sequence comprising an exonic sequence which corrects the mutation; and
(ii) a second strand comprising a nucleotide sequence complementary to the first strand, wherein the donor polynucleotide is at least 25 and up to 500 nucleotides in length, and wherein when the donor polynucleotide is introduced into the cell in combination with a site-directed nuclease, a non-homologous end-joining (NHEJ) DNA repair pathway inserts the donor polynucleotide into a double-stranded DNA break (DSB) introduced into the gDNA by the site-directed nuclease at a location proximal to the mutation, thereby correcting the mutation.

### Claim 2 (depends on 1)

The donor polynucleotide of claim 1, wherein the donor polynucleotide is up to 400, 300, 200, 100, 80, 70, or 60 nucleotides in length.

### Claim 3 (depends on 1)

The donor polynucleotide of claim 1, wherein the donor polynucleotide is 30-70 or 40-60 nucleotides in length.

### Claim 4 (depends on 1)

The donor polynucleotide of claim 1, wherein the mutation is an amino acid substitution of arginine (R) at position 83 in the G6PC gene, and wherein the exonic sequence comprises a codon encoding arginine (R) corresponding to the codon at position 83 in the G6PC gene.

### Claim 5 (depends on 1)

The donor polynucleotide of claim 1, wherein insertion of the donor polynucleotide into the DSB results in the formation of an exon in the gDNA comprising the exonic sequence.

### Claim 6 (depends on 5)

The donor polynucleotide of claim 5, wherein the splicing signals direct the inclusion of the exon comprising the exonic sequence which corrects the mutation into an mRNA.

### Claim 7 (depends on 1)

The donor polynucleotide of claim 1, wherein the branch point sequence comprises the nucleotide sequence TTCAT, wherein the polypyrimidine tract comprises the nucleotide sequence CTTGTTCTGTTTTTTT (SEQ ID NO: 109), wherein the 3′ splice site comprises the nucleotide sequence TAG.

### Claim 8 (depends on 1)

The donor polynucleotide of claim 1, wherein the branch point sequence comprises the nucleotide sequence TTCAT, wherein the polypyrimidine tract comprises the nucleotide sequence CTTGTTCTGTTTTTTT (SEQ ID NO: 109), wherein the 3′ splice site comprises the nucleotide sequence TAG, wherein the exonic sequence comprises the nucleotide sequence GATTCTCTTTGGACAGCGCCCTTACT (SEQ ID NO: 110).

### Claim 9 (depends on 1)

The donor polynucleotide of claim 1, wherein the donor polynucleotide comprises two blunt ends.

### Claim 10 (depends on 1)

A system to correct a mutation that causes GSD1a in a gDNA in a cell, the system comprising the components:
(a) the donor polynucleotide according to claim 1;
(b) one or more gRNA molecules; and
(c) a site-directed nuclease,
wherein when the system is introduced into a cell, a non-homologous end-joining (NHEJ) DNA repair pathway inserts the donor polynucleotide into a double-stranded DNA break (DSB) introduced into the gDNA by the site-directed nuclease at a location proximal to the mutation, thereby correcting the mutation.

### Claim 11 (depends on 10)

The system of claim 10, wherein the site-directed nuclease is encoded by an mRNA.

### Claim 12 (depends on 10)

The system of claim 10, wherein the site-directed nuclease is a Cas nuclease.

### Claim 13 (depends on 12)

The system of claim 12, wherein the Cas nuclease is S. pyogenes Cas9 (SpCas9) or a homolog, derivative or modified version thereof.

### Claim 14 (depends on 10)

The system of claim 10, wherein the donor polynucleotide, the gRNA molecule and the site-directed nuclease are individually formulated in a liposome or lipid nanoparticle.

### Claim 15 (depends on 10)

The system of claim 10, wherein the donor polynucleotide, the gRNA molecule and the site-directed nuclease are co-formulated in a liposome or lipid nanoparticle.

### Claim 16 (depends on 10)

The system of claim 10, wherein the nucleotide sequence of the gRNA comprises the nucleotide sequence set forth in SEQ ID NO: 107 or SEQ ID NO: 108.

### Claim 17 (depends on 10)

The system of claim 10, wherein the donor polynucleotide is up to 400, 300, 200, 100, 80, 70, or 60 nucleotides in length.

### Claim 18 (depends on 10)

The system of claim 10, wherein the donor polynucleotide is 30-70 or 40-60 nucleotides in length.

### Claim 19 (depends on 10)

The system of claim 10, wherein the mutation is an amino acid substitution of arginine (R) at position 83 in the G6PC gene, and wherein the exonic sequence comprises a codon encoding arginine (R) corresponding to the codon at position 83 in the G6PC gene.

### Claim 20 (depends on 10)

The system of claim 10, wherein insertion of the donor polynucleotide into the DSB results in the formation of an exon in the gDNA comprising the exonic sequence.

### Claim 21 (depends on 20)

The system of claim 20, wherein the splicing signals direct the inclusion of the exon comprising the exonic sequence which corrects the mutation into an mRNA.

### Claim 22 (depends on 10)

The system of claim 10, wherein the branch point sequence comprises the nucleotide sequence TTCAT, wherein the polypyrimidine tract comprises the nucleotide sequence CTTGTTCTGTTTTTTT (SEQ ID NO: 109), wherein the 3′ splice site comprises the nucleotide sequence TAG.

### Claim 23 (depends on 10)

The system of claim 10, wherein the branch point sequence comprises the nucleotide sequence TTCAT, wherein the polypyrimidine tract comprises the nucleotide sequence CTTGTTCTGTTTTTTT (SEQ ID NO: 109), wherein the 3′ splice site comprises the nucleotide sequence TAG, wherein the exonic sequence comprises the nucleotide sequence GATTCTCTTTGGACAGCGCCCTTACT (SEQ ID NO: 110).

### Claim 24 (depends on 10)

The system of claim 10, wherein the donor polynucleotide comprises two blunt ends.

### Claim 25 (depends on 1)

A cell comprising the donor polynucleotide of claim 1.

### Claim 26 (depends on 25)

The cell of claim 25, wherein the cell is a dividing or non-dividing cell.

### Claim 27 (depends on 1)

A pharmaceutical composition comprising the donor polynucleotide according to claim 1, and a pharmaceutically acceptable carrier.

### Claim 28 (depends on 10)

A method to correct a mutation in a gDNA in a cell, the method comprising: contacting the cell with the system according to claim 10, wherein when the system contacts the cell, a non-homologous end-joining (NHEJ) DNA repair pathway inserts the donor polynucleotide into a double-stranded DNA break introduced into the gDNA at a location proximal to the mutation, thereby correcting the mutation.